Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRPS28-mitochondrial ribosomal protein S28 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPS28-mitochondrial ribosomal protein S28 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010150 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPS28 |
| Origin species: | Human |
| Product name: | MRPS28-mitochondrial ribosomal protein S28 Gene |
| Size: | 2ug |
| Accessions: | BC010150 |
| Gene id: | 28957 |
| Gene description: | mitochondrial ribosomal protein S28 |
| Synonyms: | HSPC007; MRP-S28; MRP-S35; MRPS35; 28S ribosomal protein S28, mitochondrial; 28S ribosomal protein S35, mitochondrial; S28mt; S35mt; mitochondrial 28S ribosomal protein S35; mitochondrial ribosomal protein S28 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgctgtgtcggacccgtgctgtggctgccgagagccattttctgcgagtgtttctcttcttcaggccctttcggggtgtaggcactgagagtggatccgaaagtggtagttccaatgccaaggagcctaagacgcgcgcaggcggtttcgcgagcgcgttggagcggcactcggagcttctacagaaggtggagcccctacagaagggttctccaaaaaatgtggaatcctttgcatctatgctgagacattctcctcttacacagatgggacctgcaaaggataaactggtcattggacggatctttcatattgtggagaatgatctgtacatagattttggtggaaagtttcattgtgtatgtagaagaccagaagtggatggagagaaataccagaaaggaaccagggtccggttgcggctattagatcttgaacttacgtctaggttcctgggagcaacaacagatacaactgtactagaggctaatgcagttctcttgggaatccaggagagtaaagactcaagatcgaaagaagaacatcatgaaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 7 open reading frame 50 - golgi SNAP receptor complex member 2 - integrin beta 1 binding protein 1 - mitochondrial ribosomal protein S10 |