Login to display prices
Login to display prices
MRPS28-mitochondrial ribosomal protein S28 Gene View larger

MRPS28-mitochondrial ribosomal protein S28 Gene

PTXBC010150

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS28-mitochondrial ribosomal protein S28 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS28-mitochondrial ribosomal protein S28 Gene

Proteogenix catalog: PTXBC010150
Ncbi symbol: MRPS28
Product name: MRPS28-mitochondrial ribosomal protein S28 Gene
Size: 2ug
Accessions: BC010150
Gene id: 28957
Gene description: mitochondrial ribosomal protein S28
Synonyms: HSPC007; MRP-S28; MRP-S35; MRPS35; 28S ribosomal protein S28, mitochondrial; 28S ribosomal protein S35, mitochondrial; S28mt; S35mt; mitochondrial 28S ribosomal protein S35; mitochondrial ribosomal protein S28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgctgtgtcggacccgtgctgtggctgccgagagccattttctgcgagtgtttctcttcttcaggccctttcggggtgtaggcactgagagtggatccgaaagtggtagttccaatgccaaggagcctaagacgcgcgcaggcggtttcgcgagcgcgttggagcggcactcggagcttctacagaaggtggagcccctacagaagggttctccaaaaaatgtggaatcctttgcatctatgctgagacattctcctcttacacagatgggacctgcaaaggataaactggtcattggacggatctttcatattgtggagaatgatctgtacatagattttggtggaaagtttcattgtgtatgtagaagaccagaagtggatggagagaaataccagaaaggaaccagggtccggttgcggctattagatcttgaacttacgtctaggttcctgggagcaacaacagatacaactgtactagaggctaatgcagttctcttgggaatccaggagagtaaagactcaagatcgaaagaagaacatcatgaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice