RSPO2-R-spondin 2 homolog (Xenopus laevis) Gene View larger

RSPO2-R-spondin 2 homolog (Xenopus laevis) Gene

PTXBC027938

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RSPO2-R-spondin 2 homolog (Xenopus laevis) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RSPO2-R-spondin 2 homolog (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027938
Product type: DNA & cDNA
Ncbi symbol: RSPO2
Origin species: Human
Product name: RSPO2-R-spondin 2 homolog (Xenopus laevis) Gene
Size: 2ug
Accessions: BC027938
Gene id: 340419
Gene description: R-spondin 2 homolog (Xenopus laevis)
Synonyms: CRISTIN2; R-spondin-2; R-spondin 2 homolog; roof plate-specific spondin-2; R-spondin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgccagtatggagagtgcctgcattcctgcccatccgggtactatggacaccgagccccagatatgaacagatgtgcaagatgcagaatagaaaactgtgattcttgctttagcaaagacttttgtaccaagtgcaaagtaggcttttatttgcatagaggccgttgctttgatgaatgtccagatggttttgcaccattagaagaaaccatggaatgtgtggaaggatgtgaagttggtcattggagcgaatggggaacttgtagcagaaataatcgcacatgtggatttaaatggggtctggaaaccagaacacggcaaattgttaaaaagccagtgaaagacacaataccgtgtccaaccattgctgaatccaggagatgcaagatgacaatgaggcattgtccaggagggaagagaacaccaaaggcgaaggagaagaggaacaagaaaaagaaaaggaagctgatagaaagggcccaggagcaacacagcgtcttcctagctacagacagagctaaccaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 61
- mal, T-cell differentiation protein 2
- chromosome 9 open reading frame 89
- chromosome 3 open reading frame 60

Buy RSPO2-R-spondin 2 homolog (Xenopus laevis) Gene now

Add to cart