C9orf61-chromosome 9 open reading frame 61 Gene View larger

C9orf61-chromosome 9 open reading frame 61 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf61-chromosome 9 open reading frame 61 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf61-chromosome 9 open reading frame 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021685
Product type: DNA & cDNA
Ncbi symbol: C9orf61
Origin species: Human
Product name: C9orf61-chromosome 9 open reading frame 61 Gene
Size: 2ug
Accessions: BC021685
Gene id: 9413
Gene description: chromosome 9 open reading frame 61
Synonyms: C9orf61; X123; protein FAM189A2; Friedreich ataxia region gene X123; family with sequence similarity 189 member A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccgcaggatggttggtcctgatgttattcccctgccacacatctacggagctcgaatcaaaggtgtggaagtgttctgtcctctggatcccccgccgccatatgaagctgtggtgagccagatggaccaggagcagggatcttcattccaaatgtcagaaggatcagaagctgctgtgatcccattggatctgggctgcacacaagtgactcaagatggggacattcctaacatacctgccgaagaaaatgcatccacctcaactcccagttcaaccctggtgcgtcctatcagaagccggagagccctcccacccttgaggaccaggtcgaagagtgaccctgtgctccatccttctgaggagagagataatggccccattgcagcccagcacatccagggcccacaagctgccctcgcggagacagcctggcctgctgcacctccagagctgcggcgaccttcacaccttcacaccagcggggaggccccgagccgagaggaggccccggcgagtggaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mal, T-cell differentiation protein 2
- chromosome 9 open reading frame 89
- chromosome 3 open reading frame 60
- RAP1B, member of RAS oncogene family

Buy C9orf61-chromosome 9 open reading frame 61 Gene now

Add to cart