Login to display prices
Login to display prices
C9orf89-chromosome 9 open reading frame 89 Gene View larger

C9orf89-chromosome 9 open reading frame 89 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf89-chromosome 9 open reading frame 89 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf89-chromosome 9 open reading frame 89 Gene

Proteogenix catalog: PTXBC004500
Ncbi symbol: C9orf89
Product name: C9orf89-chromosome 9 open reading frame 89 Gene
Size: 2ug
Accessions: BC004500
Gene id: 84270
Gene description: chromosome 9 open reading frame 89
Synonyms: C9orf89; caspase recruitment domain-containing protein 19; Bcl10-interacting protein with CARD; bcl10-interacting CARD protein; caspase recruitment domain family member 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagatcagacctattgtgaccgcctggtgcaggacacgcctttcctgacaggccatgggcgcttgagtgagcagcaggtggacaggatcatcctccagctgaaccgttactacccacagatccttaccaacaaggaggcggaaaagttccggaaccccaaggcatccttgcgtgtgcggctttgtgacctcctgagccacctgcagcggagcggtgagcgggactgccaggagttctaccgagccctgtatatccatgcccagcccctgcacagccgcctgcccagccgccacgctctgcagaactcagattgcacagagctagactcgggcagccagagcggcgagctgagtaacaggggacccatgagcttcctggctggcctgggccttgctgtgggactggccctgctcctgtactgctatccgccagaccccaagggcctgccagggacccggcgcgtcctcggtttctcgcctgtcatcatcgacagacatgtcagccgctacctgctggccttcctggcagatgacctaggggggctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice