No products
Prices are tax excluded
PTXBC004500
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004500 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C9orf89 |
| Origin species: | Human |
| Product name: | C9orf89-chromosome 9 open reading frame 89 Gene |
| Size: | 2ug |
| Accessions: | BC004500 |
| Gene id: | 84270 |
| Gene description: | chromosome 9 open reading frame 89 |
| Synonyms: | C9orf89; caspase recruitment domain-containing protein 19; Bcl10-interacting protein with CARD; bcl10-interacting CARD protein; caspase recruitment domain family member 19 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacagatcagacctattgtgaccgcctggtgcaggacacgcctttcctgacaggccatgggcgcttgagtgagcagcaggtggacaggatcatcctccagctgaaccgttactacccacagatccttaccaacaaggaggcggaaaagttccggaaccccaaggcatccttgcgtgtgcggctttgtgacctcctgagccacctgcagcggagcggtgagcgggactgccaggagttctaccgagccctgtatatccatgcccagcccctgcacagccgcctgcccagccgccacgctctgcagaactcagattgcacagagctagactcgggcagccagagcggcgagctgagtaacaggggacccatgagcttcctggctggcctgggccttgctgtgggactggccctgctcctgtactgctatccgccagaccccaagggcctgccagggacccggcgcgtcctcggtttctcgcctgtcatcatcgacagacatgtcagccgctacctgctggccttcctggcagatgacctaggggggctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 3 open reading frame 60 - RAP1B, member of RAS oncogene family - mitochondrial ribosomal protein S28 - chromosome 7 open reading frame 50 |