Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MAL2-mal, T-cell differentiation protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAL2-mal, T-cell differentiation protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012367 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAL2 |
| Origin species: | Human |
| Product name: | MAL2-mal, T-cell differentiation protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC012367 |
| Gene id: | 114569 |
| Gene description: | mal, T-cell differentiation protein 2 |
| Synonyms: | MAL2 proteolipid protein; protein MAL2; MAL proteolipid protein 2; mal, T-cell differentiation protein 2 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggccggcggagcgtcagtcccgccgcccccgaaccccgccgtgtccttcccgccgccccgggtcaccctgcccgccggccccgacatcctgcggacctactcgggcgccttcgtctgcctggagattctgttcgggggtcttgtctggattttggttgcctcctccaatgttcctctacctctactacaaggatgggtcatgtttgtgtccgtgacagcgtttttcttttcgctcctctttctgggcatgttcctctctggcatggtggctcaaattgatgctaactggaacttcctggattttgcctaccattttacagtatttgtcttctattttggagcctttttattggaagcagcagccacatccctgcatgatttgcattgcaatacaaccataaccgggcagccactcctgagtgataaccagtataacataaacgtagcagcctcaatttttgcctttatgacgacagcttgttatggttgcagtttgggtctggctttacgaagatggcgaccgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 89 - chromosome 3 open reading frame 60 - RAP1B, member of RAS oncogene family - mitochondrial ribosomal protein S28 |