MAL2-mal, T-cell differentiation protein 2 Gene View larger

MAL2-mal, T-cell differentiation protein 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAL2-mal, T-cell differentiation protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAL2-mal, T-cell differentiation protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012367
Product type: DNA & cDNA
Ncbi symbol: MAL2
Origin species: Human
Product name: MAL2-mal, T-cell differentiation protein 2 Gene
Size: 2ug
Accessions: BC012367
Gene id: 114569
Gene description: mal, T-cell differentiation protein 2
Synonyms: MAL2 proteolipid protein; protein MAL2; MAL proteolipid protein 2; mal, T-cell differentiation protein 2 (gene/pseudogene)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggccggcggagcgtcagtcccgccgcccccgaaccccgccgtgtccttcccgccgccccgggtcaccctgcccgccggccccgacatcctgcggacctactcgggcgccttcgtctgcctggagattctgttcgggggtcttgtctggattttggttgcctcctccaatgttcctctacctctactacaaggatgggtcatgtttgtgtccgtgacagcgtttttcttttcgctcctctttctgggcatgttcctctctggcatggtggctcaaattgatgctaactggaacttcctggattttgcctaccattttacagtatttgtcttctattttggagcctttttattggaagcagcagccacatccctgcatgatttgcattgcaatacaaccataaccgggcagccactcctgagtgataaccagtataacataaacgtagcagcctcaatttttgcctttatgacgacagcttgttatggttgcagtttgggtctggctttacgaagatggcgaccgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 89
- chromosome 3 open reading frame 60
- RAP1B, member of RAS oncogene family
- mitochondrial ribosomal protein S28

Buy MAL2-mal, T-cell differentiation protein 2 Gene now

Add to cart