No products
Prices are tax excluded
PTXBC141940
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC141940 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC646938 |
| Origin species: | Human |
| Product name: | LOC646938-similar to TBC1 domain family, member 2B Gene |
| Size: | 2ug |
| Accessions: | BC141940 |
| Gene id: | 646938 |
| Gene description: | similar to TBC1 domain family, member 2B |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggacaggcaggaagtccttcggggcatttctgtttcatcacagcttttcctggggctggaagctgatcagtatctcctttggggacctgaaccctttccccgtacgccagatccggaaccaacgcgcctaccacttggagaaagtccggctggagctgaccgagctggaggccatccgtgaggacttcctgcatgagcgggacaccagccctgacaagggtgagctggtcagtgacgaggaggaggatacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - arginine-rich, mutated in early stage tumors - heterogeneous nuclear ribonucleoprotein A3 - ribosomal protein L27a - PCI domain containing 2 |