> >>ARMET-arginine-rich, mutated in early stage tumors Gene
ARMET-arginine-rich, mutated in early stage tumors Gene View larger

ARMET-arginine-rich, mutated in early stage tumors Gene

PTXBC113588

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ARMET-arginine-rich, mutated in early stage tumors Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARMET-arginine-rich, mutated in early stage tumors Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC113588
Product type: DNA & cDNA
Ncbi symbol: ARMET
Origin species: Human
Product name: ARMET-arginine-rich, mutated in early stage tumors Gene
Size: 2ug
Accessions: BC113588
Gene id: 7873
Gene description: arginine-rich, mutated in early stage tumors
Synonyms: ARMET; ARP; mesencephalic astrocyte-derived neurotrophic factor; arginine-rich, mutated in early stage tumors; mesencephalic astrocyte derived neurotrophic factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggaggatgaggaggatgtgggccacgcaggggctggcggtggcgctggctctgagcgtgctgccgggcagccgggcgctgcggccgggcgactgcgaagtttgtatttcttatctgggaagattttaccaggacctcaaagacagagatgtcacattctcaccagccactattgaaaacgaacttataaagttctgccgggaagcaagaggcaaagagaatcggttgtgctactatatcggggccacagatgatgcagccaccaaaatcatcaatgaggtatcaaagcctctggcccaccacatccctgtggagaagatctgtgagaagcttaagaagaaggacagccagatatgtgagcttaagtatgacaagcagatcgacctgagcacagtggacctgaagaagctccgagttaaagagctgaagaagattctggatgactggggggagacatgcaaaggctgtgcagaaaagtctgactacatccggaagataaatgaactgatgcctaaatatgcccccaaggcagccagtgcacggaccgatttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein A3
- ribosomal protein L27a
- PCI domain containing 2
- serine incorporator 2

Reviews

Buy ARMET-arginine-rich, mutated in early stage tumors Gene now

Add to cart