PCID2-PCI domain containing 2 Gene View larger

PCID2-PCI domain containing 2 Gene

PTXBC008975

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCID2-PCI domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCID2-PCI domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008975
Product type: DNA & cDNA
Ncbi symbol: PCID2
Origin species: Human
Product name: PCID2-PCI domain containing 2 Gene
Size: 2ug
Accessions: BC008975
Gene id: 55795
Gene description: PCI domain containing 2
Synonyms: F10; PCI domain-containing protein 2; CSN12-like protein; PCI domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgattgtcagccgctgtggcactggtgggagtgtcacggagcatgcaaatgaggttgtaatgaagttggaggccctgcaaaggccaggtggacttccacttagcatcctgctggtcttagctggtttaaccaagaggggagcctctgacctcaggcatcctattgctgaagataggcagagtttgagttgtgcaactgttcagccaagcctacaagatgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine incorporator 2
- ribosomal protein L35a
- orthodenticle homeobox 2
- ribosomal protein S15a

Buy PCID2-PCI domain containing 2 Gene now

Add to cart