Login to display prices
Login to display prices
OTX2-orthodenticle homeobox 2 Gene View larger

OTX2-orthodenticle homeobox 2 Gene

PTXBC032579

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OTX2-orthodenticle homeobox 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OTX2-orthodenticle homeobox 2 Gene

Proteogenix catalog: PTXBC032579
Ncbi symbol: OTX2
Product name: OTX2-orthodenticle homeobox 2 Gene
Size: 2ug
Accessions: BC032579
Gene id: 5015
Gene description: orthodenticle homeobox 2
Synonyms: homeobox protein OTX2; CPHD6; MCOPS5; orthodenticle homolog 2; orthodenticle homeobox 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtcttatcttaagcaaccgccttacgcagtcaatgggctgagtctgaccacttcgggtatggacttgctgcacccctccgtgggctacccggggccctgggcttcttgtcccgcagccaccccccggaaacagcgccgggagaggacgacgttcactcgggcgcagctagatgtgctggaagcactgtttgccaagacccggtacccagacatcttcatgcgagaggaggtggcactgaaaatcaacttgcccgagtcgagggtgcaggtatggtttaagaatcgaagagctaagtgccgccaacaacagcaacaacagcagaatggaggtcaaaacaaagtgagacctgccaaaaagaagacatctccagctcgggaagtgagttcagagagtggaacaagtggccaattcactcccccctctagcacctcagtcccgaccattgccagcagcagtgctcctgtgtctatctggagcccagcttccatctccccactgtcagatcccttgtccacctcctcttcctgcatgcagaggtcctatcccatgacctatactcaggcttcaggttatagtcaaggatatgctggctcaacttcctactttgggggcatggactgtggatcatatttgacccctatgcatcaccagcttcccggaccaggggccacactcagtcccatgggtaccaatgcagtcaccagccatctcaatcagtccccagcttctctttccacccagggatatggagcttcaagcttgggttttaactcaaccactgattgcttggattataaggaccaaactgcctcctggaagcttaacttcaatgctgactgcttggattataaagatcagacatcctcgtggaaattccaggttttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: