OTX2-orthodenticle homeobox 2 Gene View larger

OTX2-orthodenticle homeobox 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OTX2-orthodenticle homeobox 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OTX2-orthodenticle homeobox 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032579
Product type: DNA & cDNA
Ncbi symbol: OTX2
Origin species: Human
Product name: OTX2-orthodenticle homeobox 2 Gene
Size: 2ug
Accessions: BC032579
Gene id: 5015
Gene description: orthodenticle homeobox 2
Synonyms: homeobox protein OTX2; CPHD6; MCOPS5; orthodenticle homolog 2; orthodenticle homeobox 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtcttatcttaagcaaccgccttacgcagtcaatgggctgagtctgaccacttcgggtatggacttgctgcacccctccgtgggctacccggggccctgggcttcttgtcccgcagccaccccccggaaacagcgccgggagaggacgacgttcactcgggcgcagctagatgtgctggaagcactgtttgccaagacccggtacccagacatcttcatgcgagaggaggtggcactgaaaatcaacttgcccgagtcgagggtgcaggtatggtttaagaatcgaagagctaagtgccgccaacaacagcaacaacagcagaatggaggtcaaaacaaagtgagacctgccaaaaagaagacatctccagctcgggaagtgagttcagagagtggaacaagtggccaattcactcccccctctagcacctcagtcccgaccattgccagcagcagtgctcctgtgtctatctggagcccagcttccatctccccactgtcagatcccttgtccacctcctcttcctgcatgcagaggtcctatcccatgacctatactcaggcttcaggttatagtcaaggatatgctggctcaacttcctactttgggggcatggactgtggatcatatttgacccctatgcatcaccagcttcccggaccaggggccacactcagtcccatgggtaccaatgcagtcaccagccatctcaatcagtccccagcttctctttccacccagggatatggagcttcaagcttgggttttaactcaaccactgattgcttggattataaggaccaaactgcctcctggaagcttaacttcaatgctgactgcttggattataaagatcagacatcctcgtggaaattccaggttttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S15a
- DTW domain containing 1
- zinc finger, MYM-type 6
- glutathione peroxidase 7

Buy OTX2-orthodenticle homeobox 2 Gene now

Add to cart