GPX7-glutathione peroxidase 7 Gene View larger

GPX7-glutathione peroxidase 7 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPX7-glutathione peroxidase 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPX7-glutathione peroxidase 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032788
Product type: DNA & cDNA
Ncbi symbol: GPX7
Origin species: Human
Product name: GPX7-glutathione peroxidase 7 Gene
Size: 2ug
Accessions: BC032788
Gene id: 2882
Gene description: glutathione peroxidase 7
Synonyms: CL683; GPX6; GPx-7; GSHPx-7; NPGPx; glutathione peroxidase 7; glutathione peroxidase 6; non-selenocysteine containing phospholipid hydroperoxide glutathione peroxidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggcggcgacggtggcagcggcgtggctgctcctgtgggctgcggcctgcgcgcagcaggagcaggacttctacgacttcaaggcggtcaacatccggggcaaactggtgtcgctggagaagtaccgcggatcggtgtccctggtggtgaatgtggccagcgagtgcggcttcacagaccagcactaccgagccctgcagcagctgcagcgagacctgggcccccaccacttcaacgtgctcgccttcccctgcaaccagtttggccaacaggagcctgacagcaacaaggagattgagagctttgcccgccgcacctacagtgtctcattccccatgtttagcaagattgcagtcaccggtactggtgcccatcctgccttcaagtacctggcccagacttctgggaaggagcccacctggaacttctggaagtacctagtagccccagatggaaaggtggtaggggcttgggacccaactgtgtcagtggaggaggtcagaccccagatcacagcgctcgtgaggaagctcatcctactgaagcgagaagacttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TM2 domain containing 1
- SET domain containing 3
- TM2 domain containing 3
- FK506 binding protein 7

Buy GPX7-glutathione peroxidase 7 Gene now

Add to cart