Login to display prices
Login to display prices
FKBP7-FK506 binding protein 7 Gene View larger

FKBP7-FK506 binding protein 7 Gene

PTXBC009711

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKBP7-FK506 binding protein 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP7-FK506 binding protein 7 Gene

Proteogenix catalog: PTXBC009711
Ncbi symbol: FKBP7
Product name: FKBP7-FK506 binding protein 7 Gene
Size: 2ug
Accessions: BC009711
Gene id: 51661
Gene description: FK506 binding protein 7
Synonyms: PPIase FKBP7; peptidyl-prolyl cis-trans isomerase FKBP7; FKBP23; PPIase; 23 kDa FK506-binding protein; 23 kDa FKBP; FK506-binding protein 23; FKBP-23; FKBP-7; rotamase; FK506 binding protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaaaaaccatgcatttcttattcagattcattgttttcttttatctgtggggcctttttactgctcagagacaaaagaaagaggagagcaccgaagaagtgaaaatagaagttttgcatcgtccagaaaactgctctaagacaagcaagaagggagacctactaaatgcccattatgacggctacctggctaaagacggctcgaaattctactgcagccggacacaaaatgaaggccaccccaaatggtttgttcttggtgttgggcaagtcataaaaggcctagacattgctatgacagatatgtgccctggagaaaagcgaaaagtagttatacccccttcatttgcatacggaaaggaaggctatgcagaaggcaagattccaccggatgctacattgatttttgagattgaactttatgctgtgaccaaaggaccacggagcattgagacatttaaacaaatagacatggacaatgacaggcagctctctaaagccgagataaacctctacttgcaaagggaatttgaaaaagatgagaagccacgtgacaagtcatatcaggatgcagttttagaagatatttttaagaagaatgaccatgatggtgatggcttcatttctcccaaggaatacaatgtataccaacacgatgaactatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: