SH3GL2-SH3-domain GRB2-like 2 Gene View larger

SH3GL2-SH3-domain GRB2-like 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3GL2-SH3-domain GRB2-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SH3GL2-SH3-domain GRB2-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032825
Product type: DNA & cDNA
Ncbi symbol: SH3GL2
Origin species: Human
Product name: SH3GL2-SH3-domain GRB2-like 2 Gene
Size: 2ug
Accessions: BC032825
Gene id: 6456
Gene description: SH3-domain GRB2-like 2
Synonyms: CNSA2; EEN-B1; SH3D2A; SH3P4; endophilin-A1; Endophilin A1 BAR domain; SH3 domain containing GRB2 like 2; SH3 domain protein 2A; SH3 domain-containing GRB2-like protein 2; SH3-domain GRB2-like 2; bA335L15.1 (SH3-domain GRB2-like 2); endophilin-1; SH3 domain containing GRB2 like 2, endophilin A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggtggccggcctcaagaagcagttccataaagccactcagaaagtgagtgagaaggttggaggagctgaaggaaccaagctagatgatgacttcaaagagatggaaaggaaagtggatgtcaccagcagggctgtgatggaaataatgactaaaacaattgaataccttcaacccaatccagcttccagagctaagctcagcatgatcaacaccatgtcaaaaatccgtggccaggagaaggggccaggctatcctcaggcagaggcgctgctggcagaggccatgctcaaatttggaagagagcttggagatgattgcaactttggcccagcacttggtgaggtcggggaggccatgcgggaactgtcggaggtcaaagactctttggacatagaagtgaagcagaacttcattgaccctcttcagaatcttcatgacaaagatcttagggaaattcaacatcatctaaagaagttggagggtcgacgcctggattttgattataagaaggaacgacaaggcaagattccggatgaagagcttcgtcaagctctagagaaatttgatgagtctaaggaaattgctgagtcaagcatgttcaatctcttggagatggatattgaacaagtgagccagctctctgcacttgtgcaagctcagctggagtaccacaagcaggcagtccagatcctgcagcaagtcacggtcagactggaagaaagaataagacaggcttcatctcagcctagaagggaatatcaacctaaaccacgaatgagcctggagtttccaactggagacagtactcagcccaatgggggtctctcccactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fatty acid 2-hydroxylase
- histone deacetylase 11
- orthodenticle homeobox 1
- speckle-type POZ protein

Buy SH3GL2-SH3-domain GRB2-like 2 Gene now

Add to cart