OTX1-orthodenticle homeobox 1 Gene View larger

OTX1-orthodenticle homeobox 1 Gene

PTXBC007621

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OTX1-orthodenticle homeobox 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OTX1-orthodenticle homeobox 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007621
Product type: DNA & cDNA
Ncbi symbol: OTX1
Origin species: Human
Product name: OTX1-orthodenticle homeobox 1 Gene
Size: 2ug
Accessions: BC007621
Gene id: 5013
Gene description: orthodenticle homeobox 1
Synonyms: homeobox protein OTX1; orthodenticle homolog 1; orthodenticle homeobox 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtcttacctcaaacaacccccatacggcatgaacgggctgggcctggccgggcccgccatggacctcctgcacccatccgtgggctatccggccactccgcggaagcagcggcgggagcgcaccaccttcacgcgttcacagctggacgtgctcgaggcgctcttcgccaagactcgctaccctgacatcttcatgcgggaggaggtggcgctcaagatcaacctgccggagtctagagtccaggtctggttcaagaaccgccgcgccaaatgccgccagcagcagcagagcgggagcggaaccaagagccgcccagccaagaagaagtcctctccagtgcgggagagctcgggctccgaaagcagtggccaattcacgccgccagctgtgtccagctctgcctcgtcctctagctcggcgtccagctcttccgccaacccagcggctgcagcggctgcgggactaggtgggaacccggtggcggccgcgtcgtcgctgagtacaccagctgcctcatctatctggagcccggcctccatctcgccaggctcagcgcccgcgtccgtgtcggtgccggagccattggccgcgcctagcaacacctcgtgtatgcagcgctccgtagctgcaggcgccgccaccgcagcagcctcttatcccatgtcctacggccagggcggcagctacggccaaggctaccctacgccctcctcttcctactttggcggcgtggactgcagctcatacctagcgcccatgcactcacatcaccacccgcaccagctgagccccatggcaccctcctccatggcgggccaccatcatcaccacccacatgcgcaccacccgttgagccagtcctcaggccaccaccaccaccatcaccaccaccaccaccaaggctacggtggctctgggcttgccttcaactctgccgactgcttggattacaaggagcctggcgccgctgctgcttcctccgcctggaaactcaacttcaactcccccgactgtctggactataaggaccaagcctcatggcggttccaggtcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - speckle-type POZ protein
- PCI domain containing 2
- S100P binding protein
- neuromedin U receptor 2

Buy OTX1-orthodenticle homeobox 1 Gene now

Add to cart