S100PBP-S100P binding protein Gene View larger

S100PBP-S100P binding protein Gene

PTXBC015175

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100PBP-S100P binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100PBP-S100P binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015175
Product type: DNA & cDNA
Ncbi symbol: S100PBP
Origin species: Human
Product name: S100PBP-S100P binding protein Gene
Size: 2ug
Accessions: BC015175
Gene id: 64766
Gene description: S100P binding protein
Synonyms: S100P-binding protein; S100P binding protein 1; S100P binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtgctcacgggtgccctctgaacagtcttctggtacctctctcttgcctaaagacggtgccccattttcttgggattccttggatgaggatggattggatgactccttgctggagctgtcagagggagaagaagatgatggtgatgtaaattacacagaggaagagattgatgcactgttgaaggaagatgacccatcatatgagcagtcttctggggaagatgatggtgggcatgttgagaagggagaaagagggagtcaaattctacttgatactccccgagagaaaaattcatcgtacagcctgggaccagtagctgagactcctgacctcttcaaactacctcagctaagtacatcaagtggtcatggaccagctcatactaaaccattaaacagacgctctgtactagaaaagaatcttataaaagtaactgttgcaccatttaatccaacagtttgtgatgctctgcttgataaggacgagactgattcgtccaaagatactgaaaaactctcttcccttggagaagagatgagagaagatggtcttagcccaaatgaaagcaaactttgtactgaatctgaagggatcagccccaataactctgcctggaatgggccccagctctcttcttcaaacaataactttcaacagactgtctctgataaaaatatgcctgacagtgagaaccctacgtctgtattctctcggatctcagaccattcagagactcctaatatggagttatcctgcagaaatggtggttcacacaagtcaagttgtgaaatgagatctctggttgtttccacctcatcaaacaaacaggatgttcttaacaaggattctgggaagatgaaaggccatgagagaagactaggcaaagtcattcctgttctacaaactaagaccaggactaatgttccgacgttttcacagtcaaatctagaacagcagaagcagctttatctcaggagtgtcattgctcatatagaagacccagaggacactaaccaaggtatctcgggggagctttgtgccttgatggatcaagttcatcatatgcagcactcaaaatggcagcatccttcggacctcaccacgcgaaactacgcccgccgacagaaacatctgcaaagatacagtctgactcagtgggttgacaggaacatgcgaagccaccatcggttccagcgtctcccagacttctcgtacagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuromedin U receptor 2
- acyl-CoA thioesterase 2
- BEN domain containing 5
- fatty acid desaturase 3

Buy S100PBP-S100P binding protein Gene now

Add to cart