Login to display prices
Login to display prices
FADS3-fatty acid desaturase 3 Gene View larger

FADS3-fatty acid desaturase 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FADS3-fatty acid desaturase 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FADS3-fatty acid desaturase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004901
Product type: DNA & cDNA
Ncbi symbol: FADS3
Origin species: Human
Product name: FADS3-fatty acid desaturase 3 Gene
Size: 2ug
Accessions: BC004901
Gene id: 3995
Gene description: fatty acid desaturase 3
Synonyms: CYB5RP; LLCDL3; fatty acid desaturase 3; cytochrome b5-related protein; delta-9 fatty acid desaturase; delta-9-desaturase; linoleoyl-CoA desaturase (delta-9-desaturase)-like 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggcgtcggggagccgggaccgcgggagggacccgcgcagccgggggcaccgctgcccaccttctgctgggagcagatccgcgcgcacgaccagcccggcgacaagtggctggtcatcgagcgccgcgtctacgacatcagccgctgggcacagcggcacccagggggcagccgcctcatcggccaccacggcgctgaggacgccacggatgccttccgtgccttccatcaagatctcaattttgtgcgcaagttcctacagcccctgttgattggagagctggctccggaagaacccagccaggatggacccctgaatgcgcagctggtcgaggacttccgagccctgcaccaggcagccgaggacatgaagctgtttgatgccagtcccaccttctttgctttcctactgggccacatcctggccatggaggtgctggcctggctccttatctacctcctgggtcctggctgggtgcccagtgccctggccgccttcatcctggccatctctcaggctcagtcctggtgtctgcagcatgacctgggccatgcctccatcttcaagaagtcctggtggaaccacgtggcccagaagttcgtgatggggcagctaaagggcttctccgcccactggtggaacttccgccacttccagcaccacgccaagcccaacatcttccacaaagacccagacgtgacggtggcgcccgtcttcctcctgggggagtcatccgtcgagtatggcaagaagaaacgcagatacctaccctacaaccagcagcacctgtacttcttcctgatcggcccgccgctgctcaccctggtgaactttgaagtggaaaatctggcgtacatgctggtgtgcatgcagtgggcggatttgctctgggccgccagcttctatgcccgcttcttcttatcctacctccccttctacggcgtccctggggtgctgctcttctttgttgctgtcagggtcctggaaagccactggttcgtgtggatcacacagatgaaccacatccccaaggagatcggccacgagaagcaccgggactgggtcagctctcagctggcagccacctgcaacgtggagccctcacttttcaccaactggttcagcgggcacctcaacttccagatcgagcaccacctcttccccaggatgccgagacacaactacagccgggtggccccgctggtcaagtcgctgtgtgccaagcacggcctcagctacgaagtgaagcccttcctcaccgcgctggtggacatcgtcaggtccctgaagaagtctggtgacatctggctggacgcctacctccatcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine incorporator 1
- HtrA serine peptidase 2
- PDZ domain containing 3
- amplified in osteosarcoma