ACOT2-acyl-CoA thioesterase 2 Gene View larger

ACOT2-acyl-CoA thioesterase 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACOT2-acyl-CoA thioesterase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACOT2-acyl-CoA thioesterase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004436
Product type: DNA & cDNA
Ncbi symbol: ACOT2
Origin species: Human
Product name: ACOT2-acyl-CoA thioesterase 2 Gene
Size: 2ug
Accessions: BC004436
Gene id: 10965
Gene description: acyl-CoA thioesterase 2
Synonyms: CTE-IA; CTE1A; MTE1; PTE2; PTE2A; ZAP128; acyl-coenzyme A thioesterase 2, mitochondrial; acyl-coenzyme A thioester hydrolase 2a; long-chain acyl-CoA thioesterase 2; mitochondrial acyl-CoA thioesterase 1; peroxisomal long-chain acyl-coA thioesterase 2; acyl-CoA thioesterase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgacgctgatcctggagcctgcgggccgctgctgctgggacgaaccggtgcgaatcgccgtgcgcggcctagccccggagcagccggtcacgctgcgcgcgtccctgcgcgacgagaagggcgcgcttttccaggcccacgcgcgctaccgcgccgacactcttggcgagctggacctggagcgcgcgcccgcgctgggcggcagcttcgcggggcttgagcccatggggctgctctgggccttggagcccgagaaacctttggtgcggctggtgaagcgcgacgtgcgaacgcccttggccgtggagctggaggtgctggatggccacgaccccgaccccgggcggctgctgtgccagacgcggcacgagcgctacttcctcccgcccggggtgcggcgcgagccggtgcgcgtgggccgggtgcgaggcacgctcttcctgccgccagaacctgggccctttcctgggattgtggacatgttcggaactggaggtggcctgctggagtatcgggctagtctgctggctgggaagggttttgctgtgatggctctggcttattataactatgaagacctccccaagaccatggagacgctccatctggagtactttgaagaagccatgaactacttgctcagtcatcccgaggtaaaaggtccaggagttgggctgcttggaatttccaaagggggtgagctctgcctttccatggcctctttcctgaagggcatcacggctgctgtcgtcatcaacggctctgtggccaatgttgggggaaccttacgctacaagggcgagaccctgccccctgtgggcgtcaacagaaatcgcatcaaggtgaccaaagatggctatgcagacattgtggatgtcctgaacagccctttggaaggacctgaccagaagagcttcattcctgtggaaagggcagagagcaccttcctgttcctggtaggtcaggatgaccacaactggaagagtgagttctatgctaatgaggcctgtaaacgcttgcaggcccatgggaggagaaagccccagatcatctgttacccagagacagggcactatattgagcctccttacttccccctgtgtcgggcttccctgcatgccttggtgggcagtcctattatctggggaggggagcccagggctcatgccatggctcaggtggatgcttggaaacaactccagactttcttccacaaacacttgggtggccgcgaggggacaatcccatcaaaagtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BEN domain containing 5
- fatty acid desaturase 3
- serine incorporator 1
- HtrA serine peptidase 2

Buy ACOT2-acyl-CoA thioesterase 2 Gene now

Add to cart