SPOP-speckle-type POZ protein Gene View larger

SPOP-speckle-type POZ protein Gene

PTXBC001269

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPOP-speckle-type POZ protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPOP-speckle-type POZ protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001269
Product type: DNA & cDNA
Ncbi symbol: SPOP
Origin species: Human
Product name: SPOP-speckle-type POZ protein Gene
Size: 2ug
Accessions: BC001269
Gene id: 8405
Gene description: speckle-type POZ protein
Synonyms: BTBD32; TEF2; speckle-type POZ protein; HIB homolog 1; roadkill homolog 1; speckle type BTB/POZ protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaagggttccaagtcctccacctccggcagaaatgtcgagtggccccgtagctgagagttggtgctacacacagatcaaggtagtgaaattctcctacatgtggaccatcaataactttagcttttgccgggaggaaatgggtgaagtcattaaaagttctacattttcatcaggagcaaatgataaactgaaatggtgtttgcgagtaaaccccaaagggttagatgaagaaagcaaagattacctgtcactttacctgttactggtcagctgtccaaagagtgaagttcgggcaaaattcaaattctccatcctgaatgccaagggagaagaaaccaaagctatggagagtcaacgggcatataggtttgtgcaaggcaaagactggggattcaagaaattcatccgtagagattttcttttggatgaggccaacgggcttctccctgatgacaagcttaccctcttctgcgaggtgagtgttgtgcaagattctgtcaacatttctggccagaataccatgaacatggtaaaggttcctgagtgccggctggcagatgagttaggaggactgtgggagaattcccggttcacagactgctgcttgtgtgttgccggccaggaattccaggctcacaaggctatcttagcagctcgttctccggtttttagtgccatgtttgaacatgaaatggaggagagcaaaaagaatcgagttgaaatcaatgatgtggagcctgaagtttttaaggaaatgatgtgcttcatttacacggggaaggctccaaacctcgacaaaatggctgatgatttgctggcagctgctgacaagtatgccctggagcgcttaaaggtcatgtgtgaggatgccctctgcagtaacctgtccgtggagaacgctgcagaaattctcatcctggccgacctccacagtgcagatcagttgaaaactcaggcagtggatttcatcaactatcatgcttcggatgtcttggagacctctgggtggaagtcaatggtggtgtcacatccccacttggtggctgaggcataccgctctctggcttcagcacagtgcccttttctgggacccccacgcaaacgcctgaagcaatcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PCI domain containing 2
- S100P binding protein
- neuromedin U receptor 2
- acyl-CoA thioesterase 2

Buy SPOP-speckle-type POZ protein Gene now

Add to cart