Login to display prices
Login to display prices
HDAC11-histone deacetylase 11 Gene View larger

HDAC11-histone deacetylase 11 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDAC11-histone deacetylase 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HDAC11-histone deacetylase 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009676
Product type: DNA & cDNA
Ncbi symbol: HDAC11
Origin species: Human
Product name: HDAC11-histone deacetylase 11 Gene
Size: 2ug
Accessions: BC009676
Gene id: 79885
Gene description: histone deacetylase 11
Synonyms: HD11; histone deacetylase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctacacacaacccagctgtaccagcatgtgccagagacacgctggccaatcgtgtactcgccgcgctacaacatcaccttcatgggcctggagaagctgcatccctttgatgccggaaaatggggcaaagtgatcaatttcctaaaagaagagaagcttctgtctgacagcatgctggtggaggcgcgggaggcctcggaggaggacctgctggtggtgcacacgaggcgctatcttaatgagctcaagtggtcctttgctgttgctaccatcacagaaatcccccccgttatcttcctccccaacttccttgtgcagaggaaggtgctgaggccccttcggacccagacaggaggaaccataatggcggggaagctggctgtggagcgaggctgggccatcaacgtggggggtggcttccaccactgctccagcgaccgtggcgggggcttctgtgcctatgcggacatcacgctcgccatcaagtttctgtttgagcgtgtggagggcatctccagggctaccatcattgatcttgatgcccatcagggcaatgggcatgagcgagacttcatggacgacaagcgtgtgtacatcatggatgtctacaaccgccacatctacccaggggaccgctttgccaagcaggccatcaggcggaaggtggagctggagtggggcacagaggatgatgagtacctggataaggtggagaggaacatcaagaaatccctccaggagcacctgcccgacgtggtggtatacaatgcaggcaccgacatcctcgagggggaccgccttggggggctgtccatcagcccagcgggcatcgtgaagcgggatgagctggtgttccggatggtccgtggccgccgggtgcccatccttatggtgacctcaggcgggtaccagaagcgcacagcccgcatcattgctgactccatacttaatctgtttggcctggggctcattgggcctgagtcacccagcgtctccgcacagaactcagacacaccgctgcttccccctgcagtgccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - orthodenticle homeobox 1
- speckle-type POZ protein
- PCI domain containing 2
- S100P binding protein