Login to display prices
Login to display prices
TM2D3-TM2 domain containing 3 Gene View larger

TM2D3-TM2 domain containing 3 Gene

PTXBC008873

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM2D3-TM2 domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TM2D3-TM2 domain containing 3 Gene

Proteogenix catalog: PTXBC008873
Ncbi symbol: TM2D3
Product name: TM2D3-TM2 domain containing 3 Gene
Size: 2ug
Accessions: BC008873
Gene id: 80213
Gene description: TM2 domain containing 3
Synonyms: BLP2; TM2 domain-containing protein 3; BBP-like protein 2; beta-amyloid-binding protein-like protein 2; TM2 domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggaggggtgcgcccgctgcggggcctccgcgccttgtgtcgcgtgctgctcttcctctcgcagttctgcattctgtcgggcggtgaaagtactgaaatcccaccttatgtgatgaagtgtccgagcaatggtttgtgtagcaggcttcctgcagactgtatagactgcacaacaaatttctcctgtacctatgggaagcctgtcacttttgactgtgcagtgaaaccatctgttacctgtgttgatcaagacttcaaatcccaaaagaacttcatcattaacatgacttgcagattttgctggcagcttcctgaaacagattacgagtgtaccaactccaccagctgcatgacggtgtcctgtcctcggcagcgctaccctgccaactgcacggtgcgggaccacgtccactgcttgggtaaccgtacttttcccaaaatgctatattgcaattggactggaggctataagtggtctacggctctggctctaagcatcaccctcggtgggtttggagcagaccgtttctacctgggccagtggcgggaaggcctcggcaagctcttcagcttcggtggcctgggaatatggacgctgatagacgtcctgctcattggagttggctatgttggaccagcagatggctctttgtacatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: