TM2D1-TM2 domain containing 1 Gene View larger

TM2D1-TM2 domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM2D1-TM2 domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TM2D1-TM2 domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029486
Product type: DNA & cDNA
Ncbi symbol: TM2D1
Origin species: Human
Product name: TM2D1-TM2 domain containing 1 Gene
Size: 2ug
Accessions: BC029486
Gene id: 83941
Gene description: TM2 domain containing 1
Synonyms: BBP; TM2 domain-containing protein 1; beta-amyloid-binding protein; hBBP; TM2 domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgcctggccgtctggtccgtctgctccggaggccgtgacggccagactcgttggtgtcctgtggttcgtctcagtcactacaggaccctggggggctgttgccacctccgccgggggcgaggagtcgcttaagtgcgaggacctcaaagtgggacaatatatttgtaaagatccaaaaataaatgacgctacgcaagaaccagttaactgtacaaactacacagctcatgtttcctgttttccagcacccaacataacttgtaaggattccagtggcaatgaaacacattttactgggaacgaagttggttttttcaagcccatatcttgccgaaatgtaaatggctattcctacaaagtggcagtcgcattgtctctttttcttggatggttgggagcagatcgattttaccttggataccctgctttgggtttgttaaagttttgcactgtagggttttgtggaattgggagcctaattgatttcattcttatttcaatgcagattgttggaccttcagatggaagtagttacattatagattactatggaaccagacttacaagactgagtattactaatgaaacatttagaaaaacgcaattatatccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SET domain containing 3
- TM2 domain containing 3
- FK506 binding protein 7
- RWD domain containing 1

Buy TM2D1-TM2 domain containing 1 Gene now

Add to cart