SETD3-SET domain containing 3 Gene View larger

SETD3-SET domain containing 3 Gene

PTXBC009054

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SETD3-SET domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SETD3-SET domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009054
Product type: DNA & cDNA
Ncbi symbol: SETD3
Origin species: Human
Product name: SETD3-SET domain containing 3 Gene
Size: 2ug
Accessions: BC009054
Gene id: 84193
Gene description: SET domain containing 3
Synonyms: histone-lysine N-methyltransferase setd3; C14orf154; SET domain-containing protein 3; SET domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatgggcctctgaaaatggggcttctgtcgagggttttgaaatggttaacttcaaagaagagggctttggtttgagagcaacaagagatatcaaggcagaagaattgtttttatgggttccacgaaaattgctaatgactgttgaatctgctaaaaattcagtgttggggcccttatattctcaagaccgaatccttcaagccatgggaaacatcgcactggcctttcatttgctgtgtgagcgagccagccctaactccttctggcagccctatattcaaaccctccccagtgaatatgacactcctctctactttgaagaagatgaagttcggtatcttcagtccacacaagctatacatgatgtcttcagccagtataaaaacacagctcgacagtacgcctacttctataaagtcatccagacccatcctcatgccaacaaactacccttgaaggattctttcacttacgaggactacaggtgggcagtctcttctgttatgacgaggcaaaaccaaattcccacagaggatggttcccgcgtgaccctggctctgattcctttatgggatatgtgtaaccacaccaacggcctgacaccagaagattccttcgctcttgctgtcgcctctgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TM2 domain containing 3
- FK506 binding protein 7
- RWD domain containing 1
- elastase 3A, pancreatic

Buy SETD3-SET domain containing 3 Gene now

Add to cart