Login to display prices
Login to display prices
RPS15A-ribosomal protein S15a Gene View larger

RPS15A-ribosomal protein S15a Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS15A-ribosomal protein S15a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS15A-ribosomal protein S15a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030569
Product type: DNA & cDNA
Ncbi symbol: RPS15A
Origin species: Human
Product name: RPS15A-ribosomal protein S15a Gene
Size: 2ug
Accessions: BC030569
Gene id: 6210
Gene description: ribosomal protein S15a
Synonyms: S15a; 40S ribosomal protein S15a; up-regulated by HBV X protein; ribosomal protein S15a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcgcatgaatgtcctggcagatgctctcaagagtatcaacaatgccgaaaagagaggcaaacgccaggtgcttattaggccgtgctccaaagtcatcgtccggtttctcactgtgatgatgaagcatggttacattggcgaatttgaaatcattgatgaccacagagctgggaaaattgttgtgaacctcacaggcaggctaaacaagtgtggggtgatcagccccagatttgacgtgcaactcaaagacctggaaaaatggcagaataatctgcttccatcccgccagtttggtttcattgtactgacaacctcagctggcatcatggaccatgaagaagcaagacgaaaacacacaggagggaaaatcctgggattctttttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DTW domain containing 1
- zinc finger, MYM-type 6
- glutathione peroxidase 7
- TM2 domain containing 1