Login to display prices
Login to display prices
RPL35A-ribosomal protein L35a Gene View larger

RPL35A-ribosomal protein L35a Gene

PTXBC001037

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL35A-ribosomal protein L35a Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL35A-ribosomal protein L35a Gene

Proteogenix catalog: PTXBC001037
Ncbi symbol: RPL35A
Product name: RPL35A-ribosomal protein L35a Gene
Size: 2ug
Accessions: BC001037
Gene id: 6165
Gene description: ribosomal protein L35a
Synonyms: DBA5; L35A; 60S ribosomal protein L35a; cell growth-inhibiting gene 33 protein; ribosomal protein L35a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggaaggctgtggtccaaggccatttttgctggctataagcggggtctccggaaccaaagggagcacacagctcttcttaaaattgaaggtgtttacgcccgagatgaaacagaattctatttgggcaagagatgcgcttatgtatataaagcaaagaacaacacagtcactcctggcggcaaaccaaacaaaaccagagtcatctggggaaaagtaactcgggcccatggaaacagtggcatggttcgtgccaaattccgaagcaatcttcctgctaaggccattggacacagaatccgagtgatgctgtacccctcaaggatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: