RPL35A-ribosomal protein L35a Gene View larger

RPL35A-ribosomal protein L35a Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL35A-ribosomal protein L35a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL35A-ribosomal protein L35a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001037
Product type: DNA & cDNA
Ncbi symbol: RPL35A
Origin species: Human
Product name: RPL35A-ribosomal protein L35a Gene
Size: 2ug
Accessions: BC001037
Gene id: 6165
Gene description: ribosomal protein L35a
Synonyms: DBA5; L35A; 60S ribosomal protein L35a; cell growth-inhibiting gene 33 protein; ribosomal protein L35a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggaaggctgtggtccaaggccatttttgctggctataagcggggtctccggaaccaaagggagcacacagctcttcttaaaattgaaggtgtttacgcccgagatgaaacagaattctatttgggcaagagatgcgcttatgtatataaagcaaagaacaacacagtcactcctggcggcaaaccaaacaaaaccagagtcatctggggaaaagtaactcgggcccatggaaacagtggcatggttcgtgccaaattccgaagcaatcttcctgctaaggccattggacacagaatccgagtgatgctgtacccctcaaggatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - orthodenticle homeobox 2
- ribosomal protein S15a
- DTW domain containing 1
- zinc finger, MYM-type 6

Buy RPL35A-ribosomal protein L35a Gene now

Add to cart