SERINC2-serine incorporator 2 Gene View larger

SERINC2-serine incorporator 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERINC2-serine incorporator 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERINC2-serine incorporator 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017085
Product type: DNA & cDNA
Ncbi symbol: SERINC2
Origin species: Human
Product name: SERINC2-serine incorporator 2 Gene
Size: 2ug
Accessions: BC017085
Gene id: 347735
Gene description: serine incorporator 2
Synonyms: FKSG84; PRO0899; TDE2L; serine incorporator 2; tumor differentially expressed protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaccgaggagtgcccacctatgctagacgccacacagcagcagcagcagcaggtggcagcctgtgagggccgggcctttgacaacgagcaggacggcgtcacctacagctactccttcttccacttctgcctggtgctggcctcactgcacgtcatgatgacgctcaccaactggtacaagcccggtgagacccggaagatgatcagcacgtggaccgccgtgtgggtgaagatctgtgccagctgggcagggctgctcctctacctgtggaccctggtagccccactcctcctgcgcaaccgcgacttcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L35a
- orthodenticle homeobox 2
- ribosomal protein S15a
- DTW domain containing 1

Buy SERINC2-serine incorporator 2 Gene now

Add to cart