Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FAM19A1-family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 Gene
PTXBC025746
New product
Data sheet of FAM19A1-family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM19A1-family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025746 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM19A1 |
| Origin species: | Human |
| Product name: | FAM19A1-family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 Gene |
| Size: | 2ug |
| Accessions: | BC025746 |
| Gene id: | 407738 |
| Gene description: | family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 |
| Synonyms: | protein FAM19A1; TAFA-1; TAFA1; chemokine-like protein TAFA-1; family with sequence similarity 19 (chemokine (C-C motif)-like), member A1; family with sequence similarity 19 member A1, C-C motif chemokine like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaatggtctctgcgatgtcctgggtcctgtatttgtggataagtgcttgtgcaatgctactctgccatggatcccttcagcacactttccagcagcatcacctgcacagaccagaaggagggacgtgtgaagtgatagcagcacaccgatgttgtaacaagaatcgcattgaggagcggtcacaaacagtaaagtgttcctgtctacctggaaaagtggctggaacaacaagaaaccggccttcttgcgtcgatgcctccatagtgattgggaaatggtggtgtgagatggagccttgcctagaaggagaagaatgtaagacactccctgacaattctggatggatgtgcgcaacaggcaacaaaattaagaccacgagaattcacccaagaacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa - solute carrier family 10 (sodium/bile acid cotransporter family), member 2 - solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 - solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 |