Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LOC554203-alanyl-tRNA synthetase domain containing 1 pseudogene Gene
PTXBC029480
New product
Data sheet of LOC554203-alanyl-tRNA synthetase domain containing 1 pseudogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC554203-alanyl-tRNA synthetase domain containing 1 pseudogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029480 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC554203 |
| Origin species: | Human |
| Product name: | LOC554203-alanyl-tRNA synthetase domain containing 1 pseudogene Gene |
| Size: | 2ug |
| Accessions: | BC029480 |
| Gene id: | 554203 |
| Gene description: | alanyl-tRNA synthetase domain containing 1 pseudogene |
| Synonyms: | ENOX; LINC00183; NCRNA00183; JPX transcript, XIST activator (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatgaacaaactgagaattttcataaagaaataaaagataacaaaaagtataaagttgaagaatacaataactggactcaaaaatttaatgtgtccaacagaagaatcgatgaagcagaagaaagggctatcaaacttgtagataggccattggaaatcatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase (cAMP-dependent, catalytic) inhibitor alpha - receptor (G protein-coupled) activity modifying protein 3 - transmembrane emp24 protein transport domain containing 6 - tumor necrosis factor (ligand) superfamily, member 13b |