Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RAMP3-receptor (G protein-coupled) activity modifying protein 3 Gene
PTXBC022304
New product
Data sheet of RAMP3-receptor (G protein-coupled) activity modifying protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAMP3-receptor (G protein-coupled) activity modifying protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022304 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAMP3 |
| Origin species: | Human |
| Product name: | RAMP3-receptor (G protein-coupled) activity modifying protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC022304 |
| Gene id: | 10268 |
| Gene description: | receptor (G protein-coupled) activity modifying protein 3 |
| Synonyms: | receptor activity-modifying protein 3; CRLR activity-modifying protein 3; calcitonin receptor-like receptor activity modifying protein 3; receptor (G protein-coupled) activity modifying protein 3; receptor (calcitonin) activity modifying protein 3; receptor activity modifying protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagactggagcgctgcggcgcccgcaacttctcccgttgctgctgctgctctgcggtgggtgtcccagagcaggcggctgcaacgagacaggcatgttggagaggctgcccctgtgtgggaaggctttcgcagacatgatgggcaaggtggacgtctggaagtggtgcaacctgtccgagttcatcgtgtactatgagagtttcaccaactgcaccgagatggaggccaatgtcgtgggctgctactggcccaaccccctggcccagggcttcatcaccggcatccacaggcagttcttctccaactgcaccgtggacagggtccacttggaggaccccccagacgaggttctcatcccgctgatcgttatacccgtcgttctgactgtcgccatggctggcctggtggtgtggcgcagcaaacgcaccgacacgctgctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane emp24 protein transport domain containing 6 - tumor necrosis factor (ligand) superfamily, member 13b - zinc finger and BTB domain containing 8 opposite strand - solute carrier family 39 (zinc transporter), member 13 |