Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ZBTB8OS-zinc finger and BTB domain containing 8 opposite strand Gene
PTXBC058843
New product
Data sheet of ZBTB8OS-zinc finger and BTB domain containing 8 opposite strand Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZBTB8OS-zinc finger and BTB domain containing 8 opposite strand Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC058843 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZBTB8OS |
| Origin species: | Human |
| Product name: | ZBTB8OS-zinc finger and BTB domain containing 8 opposite strand Gene |
| Size: | 2ug |
| Accessions: | BC058843 |
| Gene id: | 339487 |
| Gene description: | zinc finger and BTB domain containing 8 opposite strand |
| Synonyms: | ARCH; ARCH2; protein archease; archease (ARCH); archease-like protein; zinc finger and BTB domain-containing opposite strand protein 8; zinc finger and BTB domain containing 8 opposite strand |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcaggaagaggaagatgttagagattacaatttgactgaagaacagaaggcgatcaaggccaagtatccgccagtcaataggaagtacgagtatttggatcatacagcagatgtccagttacacgcatggggagatactctggaggaagcatttgagcaatgtgcaatggccatgtttggttacatgacagatactgggacagtggagcccctccaaacagtagaagtagaaacccaaggagatgacttacagtctcttctgtttcactttttggatgaatggctttataagttcagtgctgatgaattcttcataccccgggtggggagaagaattttcattgtccaagcaccctcagggaacagaagtcaaagcaataacatattcagcaatgcaggtctataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 39 (zinc transporter), member 13 - nicotinate phosphoribosyltransferase domain containing 1 - nicotinate phosphoribosyltransferase domain containing 1 - hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) |