Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 305,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 305,00 €
View larger 
PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene
PTXBC011049
New product
Data sheet of PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011049 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PIK3IP1 |
| Origin species: | Human |
| Product name: | PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC011049 |
| Gene id: | 113791 |
| Gene description: | phosphoinositide-3-kinase interacting protein 1 |
| Synonyms: | HGFL; hHGFL(S); phosphoinositide-3-kinase-interacting protein 1; kringle domain-containing protein HGFL; phosphoinositide-3-kinase interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgttggcctgggtacaagcattcctcgtcagcaacatgctcctagcagaagcctatggatctggaggctgtttctgggacaacggccacctgtaccgggaggaccagacctcccccgcgccgggcctccgctgcctcaactggctggacgcgcagagcgggctggcctcggcccccgtgtcgggggccggcaatcacagttactgccgaaacccggacgaggacccgcgcgggccctggtgctacgtcagtggcgaggccggcgtccctgagaaacggccttgcgaggacctgcgctgtccagagaccacctcccaggccctgccagccttcacgacagaaatccaggaagcgtctgaagggccaggtgcagatgaggtgcaggtgttcgctcctgccaacgccctgcccgctcggagtgaggcggcagctgtgcagccagtgattgggatcagccagcgggtgcggatgaactccaaggagaaaaaggacctgggaactctgggctacgtgctgggcattaccatgatggtgatcatcattgccatcggagctggcatcatcttgggctactcctacaagagggggaaggatttgaaagaacagcatgatcagaaagtatgtgagagggagatgcagcgaatcactctgcccttgtctgccttcaccaaccccacctgtgagattgtggatgagaagactgtcgtggtccacaccagccagactccagttgaccctcaggagggcagcaccccccttatgggccaggccgggactcctggggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C1q and tumor necrosis factor related protein 6 - Yip1 interacting factor homolog A (S. cerevisiae) - SCO cytochrome oxidase deficient homolog 1 (yeast) - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase |