PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene View larger

PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011049
Product type: DNA & cDNA
Ncbi symbol: PIK3IP1
Origin species: Human
Product name: PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene
Size: 2ug
Accessions: BC011049
Gene id: 113791
Gene description: phosphoinositide-3-kinase interacting protein 1
Synonyms: HGFL; hHGFL(S); phosphoinositide-3-kinase-interacting protein 1; kringle domain-containing protein HGFL; phosphoinositide-3-kinase interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgttggcctgggtacaagcattcctcgtcagcaacatgctcctagcagaagcctatggatctggaggctgtttctgggacaacggccacctgtaccgggaggaccagacctcccccgcgccgggcctccgctgcctcaactggctggacgcgcagagcgggctggcctcggcccccgtgtcgggggccggcaatcacagttactgccgaaacccggacgaggacccgcgcgggccctggtgctacgtcagtggcgaggccggcgtccctgagaaacggccttgcgaggacctgcgctgtccagagaccacctcccaggccctgccagccttcacgacagaaatccaggaagcgtctgaagggccaggtgcagatgaggtgcaggtgttcgctcctgccaacgccctgcccgctcggagtgaggcggcagctgtgcagccagtgattgggatcagccagcgggtgcggatgaactccaaggagaaaaaggacctgggaactctgggctacgtgctgggcattaccatgatggtgatcatcattgccatcggagctggcatcatcttgggctactcctacaagagggggaaggatttgaaagaacagcatgatcagaaagtatgtgagagggagatgcagcgaatcactctgcccttgtctgccttcaccaaccccacctgtgagattgtggatgagaagactgtcgtggtccacaccagccagactccagttgaccctcaggagggcagcaccccccttatgggccaggccgggactcctggggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C1q and tumor necrosis factor related protein 6
- Yip1 interacting factor homolog A (S. cerevisiae)
- SCO cytochrome oxidase deficient homolog 1 (yeast)
- 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase

Buy PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene now

Add to cart