Login to display prices
Login to display prices
PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene View larger

PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene

PTXBC011049

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene

Proteogenix catalog: PTXBC011049
Ncbi symbol: PIK3IP1
Product name: PIK3IP1-phosphoinositide-3-kinase interacting protein 1 Gene
Size: 2ug
Accessions: BC011049
Gene id: 113791
Gene description: phosphoinositide-3-kinase interacting protein 1
Synonyms: HGFL; hHGFL(S); phosphoinositide-3-kinase-interacting protein 1; kringle domain-containing protein HGFL; phosphoinositide-3-kinase interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgttggcctgggtacaagcattcctcgtcagcaacatgctcctagcagaagcctatggatctggaggctgtttctgggacaacggccacctgtaccgggaggaccagacctcccccgcgccgggcctccgctgcctcaactggctggacgcgcagagcgggctggcctcggcccccgtgtcgggggccggcaatcacagttactgccgaaacccggacgaggacccgcgcgggccctggtgctacgtcagtggcgaggccggcgtccctgagaaacggccttgcgaggacctgcgctgtccagagaccacctcccaggccctgccagccttcacgacagaaatccaggaagcgtctgaagggccaggtgcagatgaggtgcaggtgttcgctcctgccaacgccctgcccgctcggagtgaggcggcagctgtgcagccagtgattgggatcagccagcgggtgcggatgaactccaaggagaaaaaggacctgggaactctgggctacgtgctgggcattaccatgatggtgatcatcattgccatcggagctggcatcatcttgggctactcctacaagagggggaaggatttgaaagaacagcatgatcagaaagtatgtgagagggagatgcagcgaatcactctgcccttgtctgccttcaccaaccccacctgtgagattgtggatgagaagactgtcgtggtccacaccagccagactccagttgaccctcaggagggcagcaccccccttatgggccaggccgggactcctggggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: