Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
C1QTNF6-C1q and tumor necrosis factor related protein 6 Gene
PTXBC020551
New product
Data sheet of C1QTNF6-C1q and tumor necrosis factor related protein 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1QTNF6-C1q and tumor necrosis factor related protein 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020551 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1QTNF6 |
| Origin species: | Human |
| Product name: | C1QTNF6-C1q and tumor necrosis factor related protein 6 Gene |
| Size: | 2ug |
| Accessions: | BC020551 |
| Gene id: | 114904 |
| Gene description: | C1q and tumor necrosis factor related protein 6 |
| Synonyms: | CTFP6; CTRP6; ZACRP6; complement C1q tumor necrosis factor-related protein 6; complement-c1q tumor necrosis factor-related protein 6; C1q and tumor necrosis factor related protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagtggctcagggtccgtgagtcgcctggggaggccacaggacacagggtcaccatggtgacagccgccctgggtcccgtctgggcagcgctcctgctctttctcctgatgtgtgagatccctatggtggagctcacctttgacagagctgtggccagcggctgccaacggtgctgtgactctgaggaccccctggatcctgcccatgtatcctcagcctcttcctccggccgcccccacgccctgcctgagatcagaccctacattaatatcaccatcctgaagggtgacaaaggggacccaggcccaatgggcctgccagggtacatgggcagggagggtccccaaggggagcctggccctcagggcagcaagggtgacaagggggagatgggcagccccggcgccccgtgccagaagcgcttcttcgccttctcagtgggccgcaagacggccctgcacagcggcgaggacttccagacactgctcttcgaaagggtctttgtgaaccttgatgggtgctttgacatggcgaccggccagtttgctgctcccctgcgtggcatctacttcttcagcctcaatgtgcacagctggaattacaaggagacgtacgtgcacattatgcataaccagaaagaggctgtcatcctgtacgcgcagcccagcgagcgcagcatcatgcagagccagagtgtgatgctggacctggcctacggggaccgcgtctgggtgcggctcttcaagcgccagcgcgagaacgccatctacagcaacgacttcgacacctacatcaccttcagcggccacctcatcaaggccgaggacgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Yip1 interacting factor homolog A (S. cerevisiae) - SCO cytochrome oxidase deficient homolog 1 (yeast) - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase - zinc finger protein 36, C3H type, homolog (mouse) |