YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene View larger

YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001299
Product type: DNA & cDNA
Ncbi symbol: YIF1A
Origin species: Human
Product name: YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC001299
Gene id: 10897
Gene description: Yip1 interacting factor homolog A (S. cerevisiae)
Synonyms: protein YIF1A; 54TM; FinGER7; YIF1; YIF1P; 54TMp; YIP1-interacting factor homolog A; Yip1 interacting factor homolog A; Yip1p-interacting factor; Yip1 interacting factor homolog A, membrane trafficking protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttatcactcgggctacggagcccacggctccaagcacagggcccgggcagccccggatccccctcccctcttcgatgacacaagcggtggttattccagccagcccgggggatacccagccacaggagcagacgtggccttcagtgtcaaccacttgcttggggacccaatggccaatgtggctatggcctatggcagctccatcgcatcccatgggaaggacatggtgcacaaggagctgcaccgttttgtgtctgtgagcaaactcaagtatttttttgctgtggacacagcctacgtggccaagaagctagggctgctggtcttcccctacacacaccagaactgggaagtgcagtacagtcgtgatgctcctctgcccccccggcaagacctcaacgcccctgacctctatatccccacgatggccttcattacttacgtgctcctggctgggatggcactgggcattcagaaaaggttctccccggaggtgctgggcctgtgtgcaagcacagcgctggtgtgggtggtgatggaggtgctggccctgctcctgggcctctacctggccaccgtgcgcagtgacctgagcacctttcacctgctggcctacagtggctacaaatacgtgggaatgatcctcagtgtgctcacggggctgctgttcggcagcgatggctactacgtggcgctggcctggacctcatcggcgctcatgtacttcattgtgcgctctttgcggacagcagccctgggccccgacagcatggggggccccgtcccccggcagcgtctccagctctacctgactctgggagctgcagccttccagcccctcatcatatactggctgactttccacctggtccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SCO cytochrome oxidase deficient homolog 1 (yeast)
- 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase
- zinc finger protein 36, C3H type, homolog (mouse)
- WW domain containing E3 ubiquitin protein ligase 2

Buy YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene now

Add to cart