Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene
PTXBC001299
New product
Data sheet of YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001299 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YIF1A |
| Origin species: | Human |
| Product name: | YIF1A-Yip1 interacting factor homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001299 |
| Gene id: | 10897 |
| Gene description: | Yip1 interacting factor homolog A (S. cerevisiae) |
| Synonyms: | protein YIF1A; 54TM; FinGER7; YIF1; YIF1P; 54TMp; YIP1-interacting factor homolog A; Yip1 interacting factor homolog A; Yip1p-interacting factor; Yip1 interacting factor homolog A, membrane trafficking protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttatcactcgggctacggagcccacggctccaagcacagggcccgggcagccccggatccccctcccctcttcgatgacacaagcggtggttattccagccagcccgggggatacccagccacaggagcagacgtggccttcagtgtcaaccacttgcttggggacccaatggccaatgtggctatggcctatggcagctccatcgcatcccatgggaaggacatggtgcacaaggagctgcaccgttttgtgtctgtgagcaaactcaagtatttttttgctgtggacacagcctacgtggccaagaagctagggctgctggtcttcccctacacacaccagaactgggaagtgcagtacagtcgtgatgctcctctgcccccccggcaagacctcaacgcccctgacctctatatccccacgatggccttcattacttacgtgctcctggctgggatggcactgggcattcagaaaaggttctccccggaggtgctgggcctgtgtgcaagcacagcgctggtgtgggtggtgatggaggtgctggccctgctcctgggcctctacctggccaccgtgcgcagtgacctgagcacctttcacctgctggcctacagtggctacaaatacgtgggaatgatcctcagtgtgctcacggggctgctgttcggcagcgatggctactacgtggcgctggcctggacctcatcggcgctcatgtacttcattgtgcgctctttgcggacagcagccctgggccccgacagcatggggggccccgtcccccggcagcgtctccagctctacctgactctgggagctgcagccttccagcccctcatcatatactggctgactttccacctggtccggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SCO cytochrome oxidase deficient homolog 1 (yeast) - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase - zinc finger protein 36, C3H type, homolog (mouse) - WW domain containing E3 ubiquitin protein ligase 2 |