Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
WWP2-WW domain containing E3 ubiquitin protein ligase 2 Gene
PTXBC000108
New product
Data sheet of WWP2-WW domain containing E3 ubiquitin protein ligase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about WWP2-WW domain containing E3 ubiquitin protein ligase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000108 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | WWP2 |
| Origin species: | Human |
| Product name: | WWP2-WW domain containing E3 ubiquitin protein ligase 2 Gene |
| Size: | 2ug |
| Accessions: | BC000108 |
| Gene id: | 11060 |
| Gene description: | WW domain containing E3 ubiquitin protein ligase 2 |
| Synonyms: | HECT-type E3 ubiquitin transferase WWP2; NEDD4-like E3 ubiquitin-protein ligase WWP2; WWp2-like; AIP2; atrophin-1 interacting protein 2; WW domain containing E3 ubiquitin protein ligase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatctgccagctctagccgggcaggagtggccctgccttttgagaagtctcagctcactttgaaagtggtgtccgcaaagcccaaggtgcataatcgtcaacctcgaattaactcctacgtggaggtggcggtggatggactccccagtgagaccaagaagactgggaagcgcattgggagctctgagcttctctggaatgagatcatcattttgaatgtcacggcacagagtcatttagatttaaaggtctggagctgccataccttgagaaatgaactgctaggcaccgcatctgtcaacctctccaacgtcttgaagaacaatgggggcaaaatggagaacatgcagctgaccctgaacctgcagacggagaacaaaggcagcgttgtctcaggcggagagctgacaattttcctggacgggccaactgttgatctgggaaatgtgcctaatggcagtgccctgacagatggatcacagctgccttcgagagactccagtggaacagcagtagctccagagaaccggcaccagccccccagcacaaactgctttggtggaagatcccggacgcacagacattcgggtgcttcagccagaacaaccccagcaaccggcgagcaaagccccggtgctcggagccggcaccgccagcccgtcaagaactcaggccacagtggcttggccaatggcacagtgaatgatgaacccacaacagccactgatcccgaagaaccttccgttgttggtgtgacgtccccacctgctgcacccttgagtgtgaccccgaatcccaacacgacttctctccctgccccagccacaccggctgaaggagaggaacccagcacttcgggtacacagcagctcccagcggctgcccaggcccccgacgctctgcctgctggatgggaacagcgagagctgcccaacggacgtgtctattatgttgaccacaataccaagaccaccacctgggagcggccccttcctccagggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 26 homolog B (S. pombe) - protein kinase, cAMP-dependent, catalytic, gamma - family with sequence similarity 108, member A1 - NIF3 NGG1 interacting factor 3-like 1 (S. pombe) |