Login to display prices
Login to display prices
FAM108A1-family with sequence similarity 108, member A1 Gene View larger

FAM108A1-family with sequence similarity 108, member A1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM108A1-family with sequence similarity 108, member A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM108A1-family with sequence similarity 108, member A1 Gene

Proteogenix catalog: PTXBC020512
Ncbi symbol: FAM108A1
Product name: FAM108A1-family with sequence similarity 108, member A1 Gene
Size: 2ug
Accessions: BC020512
Gene id: 81926
Gene description: family with sequence similarity 108, member A1
Synonyms: 1700013O15Rik; BC005632; D10Bwg1364e; Fam108a; protein ABHD17A; abhydrolase domain-containing protein 17A; abhydrolase domain-containing protein FAM108A; alpha/beta hydrolase domain-containing protein 17A; family with sequence similarity 108, member A; mFLJ00358 protein; abhydrolase domain containing 17A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgggctgtcgctgagtgagctctgctgcctcttctgctgcccgccctgccccggccgcatcgctgccaagctcgccttcctgccgccggaggccacctactccctggtgcctgagcccgagccggggcctggtggggccggggccgcccccttggggaccctgagagcctcctcgggcgcacccgggcgctggaagctgcacctgacggagcgtgccgacttccagtacagccagcgcgagctggacaccatcgaggtcttccccaccaagagcgcccgcggcaaccgcgtctcctgcatgtatgttcgctgcgtgcctggtgccagacaaggacaccaggctcagggaggccatccccagctggcatgggtgggcaggctgggcgactccaacaacccagcgcctggtggttgcctgctgggcgagagctggggcacaggggctgccctggcctgcgggtacatccaccttctcgccaggtacacggtcctcttctcgcacggcaatgccgtggacctgggccagatgagcagcttctacattggcctgggctcccgcctccactgcaacatcttctcctacgactactccggctacggtgccagctcgggcaggccttccgagaggaacctctatgccgacatcgacgccgcctggcaggccctgcgcaccaggtacggcatcagcccggacagcatcatcctgtacgggcagagcatcggcacggtgcccaccgtggacctggcctcgcgctacgagtgtgccgcggtggtgctgcactcgccgctcacctcgggcatgcgcgtcgccttccccgacaccaagaagacctactgcttcgacgccttccctaacatcgagaaggtgtccaagatcacgtctcccgtgctcatcatccacggcacggaggacgaggtgatcgacttctcgcacgggctggcgctctacgagcgctgccccaaggcggtggagccgctgtgggtggagggcgccgggcacaacgacatcgagctctacagccagtacctggagcgcctgcgtcgcttcatctcccaggagctgcccagccagcgcgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: