Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CHST12-carbohydrate (chondroitin 4) sulfotransferase 12 Gene
PTXBC002918
New product
Data sheet of CHST12-carbohydrate (chondroitin 4) sulfotransferase 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHST12-carbohydrate (chondroitin 4) sulfotransferase 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002918 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHST12 |
| Origin species: | Human |
| Product name: | CHST12-carbohydrate (chondroitin 4) sulfotransferase 12 Gene |
| Size: | 2ug |
| Accessions: | BC002918 |
| Gene id: | 55501 |
| Gene description: | carbohydrate (chondroitin 4) sulfotransferase 12 |
| Synonyms: | C4S-2; C4ST-2; C4ST2; carbohydrate sulfotransferase 12; carbohydrate (chondroitin 4) sulfotransferase 12; chondroitin 4-O-sulfotransferase 2; chondroitin 4-sulfotransferase 2; sulfotransferase Hlo |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccaaggcccggctgttccggctgtggctggtgctggggtcggtgttcatgatcctgctgatcatcgtgtactgggacagcgcaggcgccgcgcacttctacttgcacacgtccttctctaggccgcacacggggccgccgctgcccacgcccgggccggacagggacagggagctcacggccgactccgatgtcgacgagtttctggacaagtttctcagtgctggcgtgaagcagagcgaccttcccagaaaggagacggagcagccgcctgcgccggggagcatggaggagagcgtgagaggctacgactggtccccgcgcgacgcccggcgcagcccagaccagggccggcagcaggcggagcggaggagcgtgctgcggggcttctgcgccaactccagcctggccttccccaccaaggagcgcgcattcgacgacatccccaactcggagctgagccacctgatcgtggacgaccggcacggggccatctactgctacgtgcccaaggtggcctgcaccaactggaagcgcgtgatgatcgtgctgagcggaagcctgctgcaccgcggtgcgccctaccgcgacccgctgcgcatcccgcgcgagcacgtgcacaacgccagcgcgcacctgaccttcaacaagttctggcgccgctacgggaagctctcccgccacctcatgaaggtcaagctcaagaagtacaccaagttcctcttcgtgcgcgaccccttcgtgcgcctgatctccgccttccgcagcaagttcgagctggagaacgaggagttctaccgcaagttcgccgtgcccatgctgcggctgtacgccaaccacaccagcctgcccgcctcggcgcgcgaggccttccgcgctggcctcaaggtgtccttcgccaacttcatccagtacctgctggacccgcacacggagaagctggcgcccttcaacgagcactggcggcaggtgtaccgcctctgccacccgtgccagatcgactacgacttcgtggggaagctggagactctggacgaggacgccgcgcagctgctgcagctactccaggtggaccggcagctccgcttccccccgagctaccggaacaggaccgccagcagctgggaggaggactggttcgccaagatccccctggcctggaggcagcagctgtataaactctacgaggccgactttgttctcttcggctaccccaagcccgaaaacctcctccgagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 149, member B1 - serine/threonine kinase 25 (STE20 homolog, yeast) - serine/threonine kinase 24 (STE20 homolog, yeast) - protein tyrosine phosphatase, non-receptor type 1 |