STK24-serine/threonine kinase 24 (STE20 homolog, yeast) Gene View larger

STK24-serine/threonine kinase 24 (STE20 homolog, yeast) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STK24-serine/threonine kinase 24 (STE20 homolog, yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STK24-serine/threonine kinase 24 (STE20 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035578
Product type: DNA & cDNA
Ncbi symbol: STK24
Origin species: Human
Product name: STK24-serine/threonine kinase 24 (STE20 homolog, yeast) Gene
Size: 2ug
Accessions: BC035578
Gene id: 8428
Gene description: serine/threonine kinase 24 (STE20 homolog, yeast)
Synonyms: HEL-S-95; MST3; MST3B; STE20; STK3; serine/threonine-protein kinase 24; STE20-like kinase 3; STE20-like kinase MST3; epididymis secretory protein Li 95; mammalian STE20-like protein kinase 3; serine/threonine kinase 24 (STE20 homolog, yeast); sterile 20-like kinase 3; serine/threonine kinase 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcactccccggtgcagtcgggcctgcccggcatgcagaacctaaaggcagacccagaagagctttttacaaaactagagaaaattgggaagggctcctttggagaggtgttcaaaggcattgacaatcggactcagaaagtggttgccataaagatcattgatctggaagaagctgaagatgagatagaggacattcaacaagaaatcacagtgctgagtcagtgtgacagtccatatgtaaccaaatattatggatcctatctgaaggatacaaaattatggataataatggaatatcttggtggaggctccgcactagatctattagaacctggcccattagatgaaacccagatcgctactatattaagagaaatactgaaaggactcgattatctccattcggagaagaaaatccacagagacattaaagcggccaacgtcctgctgtctgagcatggcgaggtgaagctggcggactttggcgtggctggccagctgacagacacccagatcaaaaggaacaccttcgtgggcaccccattctggatggcacccgaggtcatcaaacagtcggcctatgactcgaaggcagacatctggtccctgggcataacagctattgaacttgcaagaggggaaccacctcattccgagctgcaccccatgaaagttttattcctcattccaaagaacaacccaccgacgttggaaggaaactacagtaaacccctcaaggagtttgtggaggcctgtttgaataaggagccgagctttagacccactgctaaggagttattgaagcacaagtttatactacgcaatgcaaagaaaacttcctacttgaccgagctcatcgacaggtacaagagatggaaggccgagcagagccatgacgactcgagctccgaggattccgacgcggaaacagatggccaagcctcggggggcagtgattctggggactggatcttcacaatccgagaaaaagatcccaagaatctcgagaatggagctcttcagccatcggacttggacagaaataagatgaaagacatcccaaagaggcctttctctcagtgtttatctacaattatttctcctctgtttgcagagttgaaggagaagagccaggcgtgcggagggaacttggggtccattgaagagctgcgaggggccatctacctagcggaggaggcgtgccctggcatctccgacaccatggtggcccagctcgtgcagcggctccagagatactctctaagtggtggaggaacttcatcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein tyrosine phosphatase, non-receptor type 1
- myosin regulatory light chain interacting protein
- major facilitator superfamily domain containing 5
- interleukin 16 (lymphocyte chemoattractant factor)

Buy STK24-serine/threonine kinase 24 (STE20 homolog, yeast) Gene now

Add to cart