MYLIP-myosin regulatory light chain interacting protein Gene View larger

MYLIP-myosin regulatory light chain interacting protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYLIP-myosin regulatory light chain interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MYLIP-myosin regulatory light chain interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002860
Product type: DNA & cDNA
Ncbi symbol: MYLIP
Origin species: Human
Product name: MYLIP-myosin regulatory light chain interacting protein Gene
Size: 2ug
Accessions: BC002860
Gene id: 29116
Gene description: myosin regulatory light chain interacting protein
Synonyms: E3 ubiquitin-protein ligase MYLIP; IDOL; MIR; E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor; band 4.1 superfamily member BZF1; cellular modulator of immune recognition (c-MIR); inducible degrader of the LDL-receptor; myosin regulatory light chain interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtgttatgtgacgaggccggacgcggtgctgatggaggtggaggtggaggcgaaagccaacggcgaggactgcctcaaccaggtgtgcaggcgactgggaatcatagaagttgactattttggactgcagtttacgggtagcaaaggtgaaagtttatggctaaacctgagaaaccggatctcccagcagatggatgggctagccccttacaggcttaaacttagagtcaagttcttcgtggagcctcatctcatcttacaggagcagactaggcatatctttttcttgcacatcaaggaggccctcttggcaggccacctcttgtgttccccagagcaggcagtggaactcagtgccctcctggcccagaccaagtttggagactacaaccagaacactgccaagtataactatgaggagctctgtgccaaggagctctcctctgccaccttgaacagcattgttgcaaaacataaggagttggaggggaccagccaggcttcagctgaataccaagttttgcagattgtgtcggcaatggaaaactatggcatagaatggcattctgtgcgggatagcgaagggcagaaactgctcattggggttggacctgaaggaatctcaatttgtaaagatgactttagcccaattaataggatagcttatcctgtggtgcagatggccacccagtcaggaaagaatgtatatttgacggtcaccaaggaatctgggaacagcatcgtgctcttgtttaaaatgatcagcaccagggcggccagcgggctctaccgagcgataacagagacgcacgcattctacaggtgtgacacagtgaccagcgccgtgatgatgcagtatagccgtgacttgaagggccacttggcatctctgtttctgaatgaaaacattaaccttggcaagaaatatgtctttgatattaaaagaacatcaaaggaggtgtatgaccatgccaggagggctctgtacaatgctggcgttgtggacctcgtttcaagaaacaaccagagcccttcacactcgcctctgaagtcctcagaaagcagcatgaactgcagcagctgcgagggcctcagctgccagcagacccgggtgctgcaggagaagctacgcaagctgaaggaagccatgctgtgcatggtgtgctgcgaggaggagatcaactccaccttctgtccctgtggccacactgtgtgctgtgagagctgcgccgcccagctacagtcatgtcccgtctgcaggtcgcgtgtggagcatgtccagcacgtctatctgccaacgcacaccagtcttctcaatctgactgtaatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major facilitator superfamily domain containing 5
- interleukin 16 (lymphocyte chemoattractant factor)
- coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
- coenzyme Q6 homolog, monooxygenase (S. cerevisiae)

Buy MYLIP-myosin regulatory light chain interacting protein Gene now

Add to cart