Login to display prices
Login to display prices
COQ6-coenzyme Q6 homolog, monooxygenase (S. cerevisiae) Gene View larger

COQ6-coenzyme Q6 homolog, monooxygenase (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COQ6-coenzyme Q6 homolog, monooxygenase (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COQ6-coenzyme Q6 homolog, monooxygenase (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014483
Product type: DNA & cDNA
Ncbi symbol: COQ6
Origin species: Human
Product name: COQ6-coenzyme Q6 homolog, monooxygenase (S. cerevisiae) Gene
Size: 2ug
Accessions: BC014483
Gene id: 51004
Gene description: coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
Synonyms: ubiquinone biosynthesis monooxygenase COQ6, mitochondrial; CGI-10; CGI10; COQ10D6; coenzyme Q10 monooxygenase 6; coenzyme Q6 homolog, monooxygenase; coenzyme Q6, monooxygenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcccggcttgtcagccgatgcggggctgtgcgtgcagctccccacagcggcccgctggtgtcctggcgcaggtggtccggcgcctcaacagacaccgtgtatgacgtggtggtgtcgggtggaggcctggtgggcgctgccatggcctgtgccttgggatatgatattcactttcatgacaagaaaatcctgttgctcgaagcaggtccaaagaaagtactggagaaattgtcagaaacttacagcaacagggtcagctccatttcccctggctctgcaacgcttctcagtagttttggtgcctgggaccatatctgcaacatgagatacagagcctttcggcgaatgcaggtgtgggacgcctgctcagaggccctgataatgtttgataaggataatttagatgacatgggctatatcgtggagaatgatgtcatcatgcatgctctcactaagcagttggaggctgtgtctgaccgagtgacggttctctacaggagcaaagccattcgctatacctggccttgtccatttcctatggccgactccagcccttgggttcatattaccctaggtgatggcagcaccttccagaccaaattgttgataggtgcagatggtcacaactccggagtacggcaggctgttggaatccagaatgtgagctggaactatgaccagtctgctgttgtggctactctgcatttatcagaggccacagaaaacaacgtagcctggcagagatttcttccctctgggcctattgctctgctcccgctctcagacaccttgagttccttggtttggtccacgtcccatgaacatgcagcagagctagttagcatggatgagaaaaaatttgtggatgccgttaactctgccttttggagtgatgctgaccacacggacttcatcgacacagctggtgccatgctgcagtatgctgtcagccttctgaagcccactaaggtctcggctcgccagctgcccccaagcgtagccagggtggatgccaaaagccgagttctgtttcctcttgggttgggacatgctgctgagtacgtcaggcctcgggtggcgctcattggggatgcagcccacagagtccatccgcttgcaggacagggtgtcaacatgggctttggggatatctccagcttggcccatcacctcagtacggcagccttcaatgggaaggacttaggttccgtgagccacctcacaggttatgaaacagaaagacagcgtcacaacactgctcttctggctgctacagacttactaaaaaggctctattctaccagtgcctccccgcttgtgttgctcaggacgtggggcttgcaggccacaaatgcagtgtctccactcaaagaacagattatggcctttgcaagcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - flavin containing monooxygenase 2 (non-functional)
- glioma tumor suppressor candidate region gene 2
- NIMA (never in mitosis gene a)- related kinase 11
- serine hydroxymethyltransferase 2 (mitochondrial)