GLTSCR2-glioma tumor suppressor candidate region gene 2 Gene View larger

GLTSCR2-glioma tumor suppressor candidate region gene 2 Gene

PTXBC006311

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLTSCR2-glioma tumor suppressor candidate region gene 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLTSCR2-glioma tumor suppressor candidate region gene 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006311
Product type: DNA & cDNA
Ncbi symbol: GLTSCR2
Origin species: Human
Product name: GLTSCR2-glioma tumor suppressor candidate region gene 2 Gene
Size: 2ug
Accessions: BC006311
Gene id: 29997
Gene description: glioma tumor suppressor candidate region gene 2
Synonyms: PICT-1; PICT1; glioma tumor suppressor candidate region gene 2 protein; p60; protein interacting with carboxyl terminus 1; glioma tumor suppressor candidate region gene 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcaggaggcagtggcgttggtgggaagcgcagctcgaaaagcgatgccgattctggtttcctggggctgcggcccacttcggtggacccagcgctgaggcggcggcggcgaggcccaagaaataagaagcggggctggcggcggcttgctcaggagccgctggggctggaggttgaccagttcctggaagacgtgcggctacaggagcgcacgagcggtggcttgttgtcagaggccccaaatgaaaaactcttcttcgtggacactggctccaaggaaaaagggctgacaaagaagagaaccaaagtccagaagaagtcactgcttctcaagaaaccccttcgggttgacctcatcctcgagaacacatccaaagtccctgcccccaaagacgtcctcgcccaccaggtccccaacgccaagaagctcaggcggaaggagcagctatgggagaagctggccaagcagggcgagctgccccgggaggtgcgcagggcccaggcccggctcctcaacccttctgcaacaagggccaagcccgggccccaggacaccgtagagcggcccttctacgacctctgggcctcagacaaccccctggacaggccgttggttggccaggatgagtttttcctggagcagaccaagaagaaaggagtgaagcggccagcacgcctgcacaccaagccgtcccaggcgcccgccgtggaggtggcgcctgccggagcttcctacaatccatcctttgaagaccaccagaccctgctctcagcggcccacgaggtggagttgcagcggcagaaggaggcggagaagctggagcggcagctggccctgcccgccacggagcaggccgccacccaggagtccacattccaggagctgtgcgaggggctgctggaggagtcggatggtgagggggagccaggccagggcgaggggccggaggctggggatgccgaggtctgtcccacgcccgcccgcctggccaccacagagaagaagacggagcagcagcggcggcgggagaaggctgtgcacaggctgcgggtacagcaggccgcgttgcgggccgcccggctccggcaccaggagctgttccggctgcgcgggatcaaggcccaggtggccctgaggctggcggagctggcgcggcggcggaggcggcggcaggcgcggcgggaggctgaggctgacaagccccgaaggctgggacggctcaagtaccaggcacctgacatcgacgtgcagctgagctcggagctgacagactcgctcaggaccctgaagcccgagggcaacatccttcgagaccggttcaagagcttccagaggaggaatatgatcgagcctcgagagagagccaagttcaaacgcaagtacaaggtgaagctggtggagaagcgggcgttccgtgagatccagttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NIMA (never in mitosis gene a)- related kinase 11
- serine hydroxymethyltransferase 2 (mitochondrial)
- ectonucleoside triphosphate diphosphohydrolase 2
- serine hydroxymethyltransferase 2 (mitochondrial)

Buy GLTSCR2-glioma tumor suppressor candidate region gene 2 Gene now

Add to cart