NEK11-NIMA (never in mitosis gene a)- related kinase 11 Gene View larger

NEK11-NIMA (never in mitosis gene a)- related kinase 11 Gene

PTXBC028587

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NEK11-NIMA (never in mitosis gene a)- related kinase 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NEK11-NIMA (never in mitosis gene a)- related kinase 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028587
Product type: DNA & cDNA
Ncbi symbol: NEK11
Origin species: Human
Product name: NEK11-NIMA (never in mitosis gene a)- related kinase 11 Gene
Size: 2ug
Accessions: BC028587
Gene id: 79858
Gene description: NIMA (never in mitosis gene a)- related kinase 11
Synonyms: serine/threonine-protein kinase Nek11; NIMA (never in mitosis gene a)- related kinase 11; NIMA related kinase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaaattccaagaggcagctaagtgtgtgagtggatcaacagccatttccacttatccaaagaccttgattgcaagaagatacgtgcttcaacaaaaacttggcagtggaagttttggaactgtctatctggtttcagacaagaaagccaaacgaggagaggaattaaaggtacttaaggaaatatctgttggagaactaaatccaaatgaaactgtacaggccaatttggaagcccaactcctctccaagctggaccacccagccattgtcaagttccatgcaagttttgtggagcaagataatttctgcattatcacggagtactgtgagggccgagatctggacgataaaattcaggaatataaacaagctggaaaaatctttccagaaaatcaaataatagaatggtttatccagctgctgctgggagttgactacatgcatgagaggaggatacttcatcgagacttaaagtcaaagaatgtatttctgaaaaataatctccttaaaattggagattttggagtttctcgacttctaatgggatcctgtgacctggccacaactttaactggaactccccattatatgagtcctgaggctctgaaacaccaaggctatgacacaaagtcggacatctggtcactggcatgcattttgtatgagatgtgctgcatgaatcatgcattcgctggctccaatttcttatccattgttttaaaaattgttgaaggtgacacaccttctctccctgagagatatccaaaagaactaaatgccatcatggaaagcatgttgaacaagaatccttcattaagaccatctgctatcgaaattttaaaaatcccttaccttgatgagcagctacagaacctaatgtgtagatattcagaaatgactctggaagacaaaaatttggattgtcagaaggaggctgctcatataattaatgccatgcaaaaaaggatccacctgcagactctgagggcactgtcagaagtacagaaaatgacgccaagagaaaggatgcggctgaggaagctccaggcggctgatgagaaagccaggaagctgaaaaagattgtggaagaaaaatatgaagaaaatagcaaacgaatgcaagaattgagatctcggaactttcagcagctgagtgttgatgtactccatgaaaaaacacatttaaaaggaatggaagaaaaggaggagcaacctgagggaagactttcttgttcaccccaggacgaggatgaagagaggtggcaaggcagggaagaggaatctgatgaaccaactttagagaacctgcctgagtctcagcctattccttccatggacctccacgaacttgaatcaattgtagaggatgccacatctgaccttggataccatggagactgtaatctaatttcactagacgaatactggaaaaatgaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine hydroxymethyltransferase 2 (mitochondrial)
- ectonucleoside triphosphate diphosphohydrolase 2
- serine hydroxymethyltransferase 2 (mitochondrial)
- RNA pseudouridylate synthase domain containing 2

Buy NEK11-NIMA (never in mitosis gene a)- related kinase 11 Gene now

Add to cart