Cart 10 Product Products 1 803,81 € (empty)
-
1 x GRAP2-GRB2...121,50 € -
-
1 x ICA1-islet...121,50 € -
1 x Goat...225,00 € -
1 x TLE6-trans...121,50 € -
1 x PER1-perio...121,50 € -
1 x Goat...387,00 € -
1 x MDFI-MyoD...113,40 € -
1 x Goat...225,00 € -
No products
To be determined Shipping
1 803,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 803,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 803,81 €
View larger 
PTPN1-protein tyrosine phosphatase, non-receptor type 1 Gene
PTXBC015660
New product
Data sheet of PTPN1-protein tyrosine phosphatase, non-receptor type 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPN1-protein tyrosine phosphatase, non-receptor type 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015660 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPN1 |
| Origin species: | Human |
| Product name: | PTPN1-protein tyrosine phosphatase, non-receptor type 1 Gene |
| Size: | 2ug |
| Accessions: | BC015660 |
| Gene id: | 5770 |
| Gene description: | protein tyrosine phosphatase, non-receptor type 1 |
| Synonyms: | tyrosine-protein phosphatase non-receptor type 1; protein tyrosine phosphatase, placental; protein-tyrosine phosphatase 1B; protein tyrosine phosphatase, non-receptor type 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatggaaaaggagttcgagcagatcgacaagtccgggagctgggcggccatttaccaggatatccgacatgaagccagtgacttcccatgtagagtggccaagcttcctaagaacaaaaaccgaaataggtacagagacgtcagtccctttgaccatagtcggattaaactacatcaagaagataatgactatatcaacgctagtttgataaaaatggaagaagcccaaaggagttacattcttacccagggccctttgcctaacacatgcggtcacttttgggagatggtgtgggagcagaaaagcaggggtgtcgtcatgctcaacagagtgatggagaaaggttcgttaaaatgcgcacaatactggccacaaaaagaagaaaaagagatgatctttgaagacacaaatttgaaattaacattgatctctgaagatatcaagtcatattatacagtgcgacagctagaattggaaaaccttacaacccaagaaactcgagagatcttacatttccactataccacatggcctgactttggagtccctgaatcaccagcctcattcttgaactttcttttcaaagtccgagagtcagggtcactcagcccggagcacgggcccgttgtggtgcactgcagtgcaggcatcggcaggtctggaaccttctgtctggctgatacctgcctcttgctgatggacaagaggaaagacccttcttccgttgatatcaagaaagtgctgttagaaatgaggaagtttcggatggggctgatccagacagccgaccagctgcgcttctcctacctggctgtgatcgaaggtgccaaattcatcatgggggactcttccgtgcaggatcagtggaaggagctttcccacgaggacctggagcccccacccgagcatatccccccacctccccggccacccaaacgaatcctggagccacacaatgggaaatgcagggagttcttcccaaatcaccagtgggtgaaggaagagacccaggaggataaagactgccccatcaaggaagaaaaaggaagccccttaaatgccgcaccctacggcatcgaaagcatgagtcaagacactgaagttagaagtcgggtcgtggggggaagtcttcgaggtgcccaggctgcctccccagccaaaggggagccgtcactgcccgagaaggacgaggaccatgcactgagttactggaagcccttcctggtcaacatgtgcgtggctacggtcctcacggccggcgcttacctctgctacaggttcctgttcaacagcaacacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin regulatory light chain interacting protein - major facilitator superfamily domain containing 5 - interleukin 16 (lymphocyte chemoattractant factor) - coenzyme Q6 homolog, monooxygenase (S. cerevisiae) |