Login to display prices
Login to display prices
ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene View larger

ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009693
Product type: DNA & cDNA
Ncbi symbol: ZFP36
Origin species: Human
Product name: ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene
Size: 2ug
Accessions: BC009693
Gene id: 7538
Gene description: zinc finger protein 36, C3H type, homolog (mouse)
Synonyms: ZFP36 ring finger protein; mRNA decay activator protein ZFP36; G0S24; GOS24; NUP475; RNF162A; TIS11; TTP; zfp-36; G0/G1 switch regulatory protein 24; growth factor-inducible nuclear protein NUP475; tristetraproline; zinc finger protein 36 homolog; zinc finger protein 36, C3H type, homolog; zinc finger protein, C3H type, 36 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatctgactgccatctacgagagcctcctgtcgctgagccctgacgtgcccgtgccatccgaccatggagggactgagtccagcccaggctggggctcctcgggaccctggagcctgagcccctccgactccagcccgtctggggtcacctcccgcctgcctggccgctccaccagcctagtggagggccgcagctgtggctgggtgcccccaccccctggcttcgcaccgctggctccccgcctgggccctgagctgtcaccctcacccacttcgcccactgcaacctccaccaccccctcgcgctacaagactgagctatgtcggaccttctcagagagtgggcgctgccgctacggggccaagtgccagtttgcccatggcctgggcgagctgcgccaggccaatcgccaccccaaatacaagacggaactctgtcacaagttctacctccagggccgctgcccctacggctctcgctgccacttcatccacaaccctagcgaagacctggcggccccgggccaccctcctgtgcttcgccagagcatcagcttctccggcctgccctctggccgccggacctcaccaccaccaccaggcctggccggcccttccctgtcctccagctccttctcgccctccagctccccaccaccacctggggaccttccactgtcaccctctgccttctctgctgcccctggcacccccctggctcgaagagaccccaccccagtctgttgcccctcctgccgaagggccactcctatcagcgtctgggggcccttgggtggcctggttcggaccccctctgtacagtccctgggatccgaccctgatgaatatgccagcagcggcagcagcctggggggctctgactctcccgtcttcgaggcgggagtttttgcaccaccccagcccgtggcagccccccggcgactccccatcttcaatcgcatctctgtttctgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WW domain containing E3 ubiquitin protein ligase 2
- vacuolar protein sorting 26 homolog B (S. pombe)
- protein kinase, cAMP-dependent, catalytic, gamma
- family with sequence similarity 108, member A1