Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL16-chemokine (C-C motif) ligand 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL16-chemokine (C-C motif) ligand 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC099662 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL16 |
| Origin species: | Human |
| Product name: | CCL16-chemokine (C-C motif) ligand 16 Gene |
| Size: | 2ug |
| Accessions: | BC099662 |
| Gene id: | 6360 |
| Gene description: | chemokine (C-C motif) ligand 16 |
| Synonyms: | CKb12; HCC-4; ILINCK; LCC-1; LEC; LMC; Mtn-1; NCC-4; NCC4; SCYA16; SCYL4; C-C motif chemokine 16; IL-10-inducible chemokine; chemokine (C-C motif) ligand 16; chemokine LEC; liver CC chemokine-1; liver-expressed chemokine; lymphocyte and monocyte chemoattractant; monotactin-1; new CC chemokine 4; small inducible cytokine subfamily A (Cys-Cys), member 16; small-inducible cytokine A16; C-C motif chemokine ligand 16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggtctccgaggctgccctgtctctccttgtcctcatccttatcattacttcggcttctcgcagccagccaaaagttcctgagtgggtgaacaccccatccacctgctgcctgaagtattatgagaaagtgttgccaaggagactagtggtgggatacagaaaggccctcaactgtcacctgccagcaatcatcttcgtcaccaagaggaaccgagaagtctgcaccaaccccaatgacgactgggtccaagagtacatcaaggatcccaacctacctttgctgcctaccaggaacttgtccacggttaaaattattacagcaaagaatggtcaaccccagctcctcaactcccagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synovial sarcoma, X breakpoint 3 - synovial sarcoma, X breakpoint 4 - protease, serine, 2 (trypsin 2) - mucin 1, cell surface associated |