PRSS2-protease, serine, 2 (trypsin 2) Gene View larger

PRSS2-protease, serine, 2 (trypsin 2) Gene

PTXBC103997

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRSS2-protease, serine, 2 (trypsin 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRSS2-protease, serine, 2 (trypsin 2) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC103997
Product type: DNA & cDNA
Ncbi symbol: PRSS2
Origin species: Human
Product name: PRSS2-protease, serine, 2 (trypsin 2) Gene
Size: 2ug
Accessions: BC103997
Gene id: 5645
Gene description: protease, serine, 2 (trypsin 2)
Synonyms: TRY2; TRY8; TRYP2; trypsin-2; anionic trypsinogen; protease serine 2 preproprotein; protease, serine, 2 (trypsin 2); trypsin II; trypsinogen 2; protease, serine 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccactcctgatccttacctttgttgcagctgctgttgctgccccctttgatgatgatgacaagatcgttgggggctacatctgtgaggagaattctgtcccctaccaggtgtccttgaattctggctaccacttctgcggtggctccctcatcagcgaacagtgggtggtgtcagcaggtcactgctacaagtcccgcatccaggtgagactgggagagcacaacatcgaagtcctggaggggaatgaacagttcatcaatgcagccaagatcatccgccaccccaaatacaacagccggactctggacaatgacatcctgctgatcaagctctcctcacctgccgtcatcaattcccgcgtgtccgccatctctctgcccactgcccctccagctgctggcaccgagtccctcatctccggctggggcaacactctgagttctggtgccgactacccagacgagctgcagtgcctggatgctcctgtgctgagccaggctgagtgtgaagcctcctaccctggaaagattaccaacaacatgttctgtgtgggcttcctcgagggaggcaaggattcctgccagggtgattctggtggccctgtggtctccaatggagagctccaaggaattgtctcctggggctatggctgtgcccagaagaacaggcctggagtctacaccaaggtctacaactatgtggactggattaaggacaccatagctgccaacagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mucin 1, cell surface associated
- G protein-coupled receptor 141
- G protein-coupled receptor 120
- tubulin folding cofactor E-like

Reviews

Buy PRSS2-protease, serine, 2 (trypsin 2) Gene now

Add to cart