Cart 3 Product Products 348,30 € (empty)
-
1 x COPS4-COP9...121,50 € -
1 x SSX3-synov...113,40 € -
1 x FAM9B-fami...113,40 €
No products
To be determined Shipping
348,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 348,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 348,30 €
Data sheet of GPR141-G protein-coupled receptor 141 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR141-G protein-coupled receptor 141 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC120951 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR141 |
| Origin species: | Human |
| Product name: | GPR141-G protein-coupled receptor 141 Gene |
| Size: | 2ug |
| Accessions: | BC120951 |
| Gene id: | 353345 |
| Gene description: | G protein-coupled receptor 141 |
| Synonyms: | PGR13; G-protein coupled receptor PGR13; G protein-coupled receptor 141 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctggccacaatacctccaggaattcctcttgcgatcctatagtgacaccccacttaatcagcctctacttcatagtgcttattggcgggctggtgggtgtcatttccattcttttcctcctggtgaaaatgaacacccggtcagtgaccaccatggcggtcattaacttggtggtggtccacagcgtttttctgctgacagtgccatttcgcttgacctacctcatcaagaagacttggatgtttgggctgcccttctgcaaatttgtgagtgccatgctgcacatccacatgtacctcacgttcctattctatgtggtgatcctggtcaccagatacctcatcttcttcaagtgcaaagacaaagtggaattctacagaaaactgcatgctgtggctgccagtgctggcatgtggacgctggtgattgtcattgtggtacccctggttgtctcccggtatggaatccatgaggaatacaatgaggagcactgttttaaatttcacaaagagcttgcttacacatatgtgaaaatcatcaactatatgatagtcatttttgtcatagccgttgctgtgattctgttggtcttccaggtcttcatcattatgttgatggtgcagaagctacgccactctttactatcccaccaggagttctgggctcagctgaaaaacctattttttataggggtcatccttgtttgtttccttccctaccagttctttaggatctattacttgaatgttgtgacgcattccaatgcctgtaacagcaaggttgcattttataacgaaatcttcttgagtgtaacagcaattagctgctatgatttgcttctctttgtctttgggggaagccattggtttaagcaaaagataattggcttatggaattgtgttttgtgccgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor 120 - tubulin folding cofactor E-like - G protein-coupled receptor 152 - TBC1 domain family, member 24 |