CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene View larger

CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001776
Product type: DNA & cDNA
Ncbi symbol: CYP27B1
Origin species: Human
Product name: CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene
Size: 2ug
Accessions: BC001776
Gene id: 1594
Gene description: cytochrome P450, family 27, subfamily B, polypeptide 1
Synonyms: CP2B; CYP1; CYP1alpha; CYP27B; P450c1; PDDR; VDD1; VDDR; VDDRI; VDR; 25-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial; 1alpha(OH)ase; 25 hydroxyvitamin D3-1-alpha hydroxylase; 25-OHD-1 alpha-hydroxylase; VD3 1A hydroxylase; calcidiol 1-monooxygenase; cytochrome P450 subfamily XXVIIB polypeptide 1; cytochrome P450, family 27,
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccagaccctcaagtacgcctccagagtgttccatcgcgtccgctgggcgcccgagttgggcgcctccctaggctaccgagagtaccactcagcacgccggagcttggcagacatcccaggcccctctacgcccagctttctggccgaacttttctgcaagggggggctgtcgaggctacacgagctgcaggtgcagggcgccgcgcacttcgggccggtgtggctagccagctttgggacagtgcgcaccgtgtacgtggctgcccctgcactcgtcgaggagctgctgcgacaggagggaccccggcccgagcgctgcagcttctcgccctggacggagcaccgccgctgccgccagcgggcttgcggactgctcactgcggaaggcgaagaatggcaaaggctccgcagtctcctggccccgctcctcctccggcctcaagcggccgcccgctacgccggaaccctgaacaacgtagtctgcgaccttgtgcggcgtctgaggcgccagcggggacgtggcacggggccgcccgccctggttcgggacgtggcgggggaattttacaagttcggactggaaggtgagtcccaggacagagctgggcaggcgtcgggggcgccctaccagagcctcccggaaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MRS2 magnesium homeostasis factor homolog (S. cerevisiae)
- cytochrome P450, family 17, subfamily A, polypeptide 1
- poly(A) binding protein, cytoplasmic 4 (inducible form)
- protein-L-isoaspartate (D-aspartate) O-methyltransferase

Buy CYP27B1-cytochrome P450, family 27, subfamily B, polypeptide 1 Gene now

Add to cart