Login to display prices
Login to display prices
ANUBL1-AN1, ubiquitin-like, homolog (Xenopus laevis) Gene View larger

ANUBL1-AN1, ubiquitin-like, homolog (Xenopus laevis) Gene

PTXBC048968

New product

Data sheet of ANUBL1-AN1, ubiquitin-like, homolog (Xenopus laevis) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANUBL1-AN1, ubiquitin-like, homolog (Xenopus laevis) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC048968
Ncbi symbol: ANUBL1
Product name: ANUBL1-AN1, ubiquitin-like, homolog (Xenopus laevis) Gene
Size: 2ug
Accessions: BC048968
Gene id: 93550
Gene description: AN1, ubiquitin-like, homolog (Xenopus laevis)
Synonyms: ANUBL1; AN1-type zinc finger protein 4; AN1, ubiquitin-like, homolog; AN1-type zinc finger and ubiquitin domain-containing protein 1; AN1-type zinc finger and ubiquitin domain-containing protein-like 1; zinc finger, AN1-type domain 4; zinc finger AN1-type containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacttgaaaatgattattgcttgaatgattacaacatttcagaagggtggaccttgaagctagttttggctatgcgtggcggacctataaatactagaagagttcctacagacgatccacttaggacgatggcagagtacttggattccagtcgagttgaggtctgggagaagacctcctgcagcaaacaagttacatttttggtataccaagaaggagatcaattgaatttctttcctgcagtagataggggagatggcactttaacaccgttatctgactcttcaaagaaaatagattttcatttgcatgtcctacggagaaaaggagaacatcgtatgagtggtggttctatgtataattcagatacagatgaggatgaagaaactgagccttcttcttctgggcaacagataattgaaaattcaataactatgaataagatgaagctgctgaaggctaagatgaagaacatgaatctcagcaaaaagcctaagaaagctgtcaagataaaacctcacccacctgtagctcctcgaccttctagtggttccactgcaccatctcgccaccgattgttaagggtcctccccaacattggtcaatcttgttcacctgcttttgggaatgcatatccgcccgaaatctccaggaatggaatttcaagtttggcaactcaactctctgctgagagatacatatcttctatcactggtgaatttcttaaggaagataatagctgggagaataacacactgtctcacttcagtagcaacgtcaaactacctcctcagataccccatttggagttgggaaatgaccaggagcttgctgactctgttctccatcttggatcatccctgcctaggcaaacaaaacattttttaggaaacttgccatctagtaatgggaacattgtcttaccttcagaagaatgtgtaaccgaacaatcacttctacctaaagtgggctcactggcttcatttgcagaaggaaatgctgatgaacagagcagcggcttagaaggtgcgtgcaaagtgaatctggagttgctactcactaatgctgacaaagggttgaaagctccagagcagcatctcaagcatgttgcaggagtgctgaatggggaatcagtagagacttcagttcttaactaccgggaattaagtcctcacaagaatagactcttgtcacctcttcgctgttctgcaccaatgtcgctacataattctctggtgaaaccagagagacagtccaaatgttttgagtttgggaagctacagccttcttcttctcagtcactggatgttcaaaacataactgattcttctttctctaggactacttgctttcaaggtgttaaagttgattcgcttgggaaaagatctgatgttatttccaaagttgaggctcgggatatcacagaaatgactaacaaggcttccaaagagcctgttggttgtgtaaataatatcagttttcttgcctcactggccgggagcacaagcagaaatagattacagagcacacgtggggcaggcaggcttcagaactctggaactgggctgtctacaaacctccagcattttcaggaagaaaactttaggaaaagttctccccagttagaacatacaggagtttttttgtctacccatggtgttggaatgaatggaaataatgcagcagcagggaaaagcgtaggagaatgtactactcatcacctcccacctgtgaaagcccctcttcagacaaagaagaaaacaacaaatcattgttttctttgtggaaagaaaacaggactggctagtagctacgaatgcagatgtggaaacaacttctgtgcatctcatcgttatgcagaaactcatggctgtacctatgattacaagagtgcagggaggagatacttgcacgaggcaaatcctgtggttaatgcaccaaagcttccaaaaatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: