Cart 19 Product Products 3 813,99 € (empty)
-
1 x FAM102A-fa...113,40 € -
-
-
1 x C7orf49-ch...113,40 € -
1 x KIAA1191-K...121,50 € -
1 x SFXN4-side...121,50 € -
1 x SMYD1-SET...121,50 € -
1 x KIF26A-kin...113,40 € -
1 x RPL35-ribo...113,40 € -
1 x HLA-F-majo...121,50 € -
1 x HMGN3-high...113,40 € -
1 x HMGA1-high...113,40 € -
1 x NOSTRIN-ni...121,50 € -
1 x ZNF614-zin...113,40 € -
1 x NTSR2-neur...121,50 € -
1 x ABHD7-abhy...121,50 € -
-
1 x ANKRD22-an...113,40 € -
1 x TSC22D4-TS...121,50 €
No products
To be determined Shipping
3 813,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 813,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 813,99 €
Data sheet of SDS-serine dehydratase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SDS-serine dehydratase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020750 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SDS |
| Origin species: | Human |
| Product name: | SDS-serine dehydratase Gene |
| Size: | 2ug |
| Accessions: | BC020750 |
| Gene id: | 10993 |
| Gene description: | serine dehydratase |
| Synonyms: | SDH; L-serine dehydratase/L-threonine deaminase; L-serine ammonia-lyase; L-serine deaminase; L-serine dehydratase; L-threonine dehydratase; TDH |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcacattttgtctgctcctcggcgggcaacgcaggcatggcggctgcatatgcggccaggcaactcggcgtccccgccaccatcgtggtgcccagcaccacacctgctctcaccattgagcgcctcaagaatgaaggtgccacagtcaaggtggtgggtgagttattggatgaagccttcgagctggccaaggccctagcgaagaacaacccgggttgggtctacattcccccctttgatgaccccctcatctgggaaggccacgcttccatcgtgaaagagctgaaggagacactgtgggaaaagccgggggccatcgcgctgtcagtgggcggcgggggcctgctgtgtggagtggtccaggggctgcaggaggtgggctggggggacgtgcctgtcatcgccatggagacttttggtgcccacagcttccacgctgccaccaccgcaggcaaacttgtctccctgcccaagatcaccaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD300c molecule - GPN-loop GTPase 3 - carboxypeptidase M - CDC-like kinase 4 |