NLGN4Y-neuroligin 4, Y-linked Gene View larger

NLGN4Y-neuroligin 4, Y-linked Gene

PTXBC032567

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NLGN4Y-neuroligin 4, Y-linked Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NLGN4Y-neuroligin 4, Y-linked Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032567
Product type: DNA & cDNA
Ncbi symbol: NLGN4Y
Origin species: Human
Product name: NLGN4Y-neuroligin 4, Y-linked Gene
Size: 2ug
Accessions: BC032567
Gene id: 22829
Gene description: neuroligin 4, Y-linked
Synonyms: neuroligin-4, Y-linked; neuroligin 4, Y-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcccatctggtttaccaccagtttggatactttgatgacctatgttcaagatcaaaatgaagactgcctttacttaaacatctatgtgcccatggaagatggaaccaacataaagagaaatgcagacgatataaccagtaatgaccatggtgaagataaagatattcatgaacagaacagtaagaagcctgttatggtctatatccatgggggatcttacatggagggaaccggtaacatgattgatggcagcattttggccagctatgggaacgtcatcgttatcaccattaactaccgtctgggaatactaggtatgcaagaggcacgtttgtgtgggagctcaaaaatgtttaattattttaaatctcctttcactaatttaataaattttttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - frizzled-related protein
- programmed cell death 6
- BEN domain containing 7
- UBA domain containing 1

Buy NLGN4Y-neuroligin 4, Y-linked Gene now

Add to cart