Login to display prices
Login to display prices
NLGN4Y-neuroligin 4, Y-linked Gene View larger

NLGN4Y-neuroligin 4, Y-linked Gene

PTXBC032567

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NLGN4Y-neuroligin 4, Y-linked Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NLGN4Y-neuroligin 4, Y-linked Gene

Proteogenix catalog: PTXBC032567
Ncbi symbol: NLGN4Y
Product name: NLGN4Y-neuroligin 4, Y-linked Gene
Size: 2ug
Accessions: BC032567
Gene id: 22829
Gene description: neuroligin 4, Y-linked
Synonyms: neuroligin-4, Y-linked; neuroligin 4, Y-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcccatctggtttaccaccagtttggatactttgatgacctatgttcaagatcaaaatgaagactgcctttacttaaacatctatgtgcccatggaagatggaaccaacataaagagaaatgcagacgatataaccagtaatgaccatggtgaagataaagatattcatgaacagaacagtaagaagcctgttatggtctatatccatgggggatcttacatggagggaaccggtaacatgattgatggcagcattttggccagctatgggaacgtcatcgttatcaccattaactaccgtctgggaatactaggtatgcaagaggcacgtttgtgtgggagctcaaaaatgtttaattattttaaatctcctttcactaatttaataaattttttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: