BEND7-BEN domain containing 7 Gene View larger

BEND7-BEN domain containing 7 Gene

PTXBC031618

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BEND7-BEN domain containing 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BEND7-BEN domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031618
Product type: DNA & cDNA
Ncbi symbol: BEND7
Origin species: Human
Product name: BEND7-BEN domain containing 7 Gene
Size: 2ug
Accessions: BC031618
Gene id: 222389
Gene description: BEN domain containing 7
Synonyms: C10orf30; BEN domain-containing protein 7; BEN domain containing 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaagattgctgaacgacagcactgggcggatctatcagcgagttggcaaagaaggagagaaactaaaagaagagccccaggacctggatttagtctggcctccacgtttgaactcctctgctgaggccccgcaaagcctccacccgtcttcacgtggtgtgtggaatgagctaccgccccagagtggacagttctcagggcagtatggcacccgttctagaaccttccaaagccagccccaccctaccacgagctccaatggtatggttgtcaacaaacattcagaaggctctcatgggggagaacttccagtggtgaattcatcagctggatcaaactgctgtacttgtaactgccagtcaacgttgcaggccattctacaagaactcaagaccatgaggaaattaatgcaaattcaagcagttggaactcaaaacagacaacaacctccaatttcccttatatgctcccagcgaactgctgtctcacgaaagagaaataaaaagaaaaaagtgcccccaaagactgtggaacctcttactgtgaaacagaagcccagtgggtcagagatggagaaaaagtcggtggtggcctctgagctatctgctctccaggcagccgagcacacctccccggaggagagccgcgttctaggattcggcattgttctggaatcaccttcctcagatccagaagtacaacttgctgaaggctttgacgtgtttatgcctaaatctcagctggactctatattgtcaaactacactcgctcaggaagccttctgtttagaaaactggtgtgtgcgttttttgatgacaagactttggctaactccttacccaatgggaagaggaaaagaggactcaatgacaaccggaaaggactagaccaaaatattgtgggtgcaataaaagtcttcacagaaaagtactgtacagctaaccatgtggataagcttcctggcccaagagattgggtgcagattctacaggatcaaattaaactggccagaagaaggttaaaaagaggctcagagatcgcggacagtgatgaaagactggacggcattgctctaccaccaacagtggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UBA domain containing 1
- N-myristoyltransferase 2
- RIMS binding protein 2
- chitobiase, di-N-acetyl-

Buy BEND7-BEN domain containing 7 Gene now

Add to cart