CTBS-chitobiase, di-N-acetyl- Gene View larger

CTBS-chitobiase, di-N-acetyl- Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTBS-chitobiase, di-N-acetyl- Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CTBS-chitobiase, di-N-acetyl- Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024007
Product type: DNA & cDNA
Ncbi symbol: CTBS
Origin species: Human
Product name: CTBS-chitobiase, di-N-acetyl- Gene
Size: 2ug
Accessions: BC024007
Gene id: 1486
Gene description: chitobiase, di-N-acetyl-
Synonyms: CTB; di-N-acetylchitobiase; chitobiase, di-N-acetyl-; chitobiase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggccgcagcttcgacgctggcgtctcgtctctagcccgccgagcggcgtcccgggtctagcgctgctggcgctgctggcgctgcggctcgcggccgggaccgactgcccatgcccggagcctgagctttgccgcccgattcgccaccatccagatttcgaggtctttgtgtttgatgttggacagaaaacttggaaatcttatgattggtcacagattacaactgtggcaacatttggaaaatatgactcagaacttatgtgctacgctcattcaaaaggagccagagtagtacttaaaggtaacctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DTW domain containing 1
- LSM domain containing 1
- LIM domain containing 2
- sterol carrier protein 2

Buy CTBS-chitobiase, di-N-acetyl- Gene now

Add to cart