Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CTBS-chitobiase, di-N-acetyl- Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTBS-chitobiase, di-N-acetyl- Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024007 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTBS |
| Origin species: | Human |
| Product name: | CTBS-chitobiase, di-N-acetyl- Gene |
| Size: | 2ug |
| Accessions: | BC024007 |
| Gene id: | 1486 |
| Gene description: | chitobiase, di-N-acetyl- |
| Synonyms: | CTB; di-N-acetylchitobiase; chitobiase, di-N-acetyl-; chitobiase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccggccgcagcttcgacgctggcgtctcgtctctagcccgccgagcggcgtcccgggtctagcgctgctggcgctgctggcgctgcggctcgcggccgggaccgactgcccatgcccggagcctgagctttgccgcccgattcgccaccatccagatttcgaggtctttgtgtttgatgttggacagaaaacttggaaatcttatgattggtcacagattacaactgtggcaacatttggaaaatatgactcagaacttatgtgctacgctcattcaaaaggagccagagtagtacttaaaggtaacctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DTW domain containing 1 - LSM domain containing 1 - LIM domain containing 2 - sterol carrier protein 2 |